Incidental Mutation 'R1598:Urb1'
ID175982
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene NameURB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms4921511H13Rik, 5730405K23Rik
MMRRC Submission 039635-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1598 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location90751527-90810413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 90777440 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 918 (V918F)
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140920]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140158
Predicted Effect possibly damaging
Transcript: ENSMUST00000140920
AA Change: V918F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: V918F

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik G A 11: 80,364,012 Q328* probably null Het
Adamts1 G A 16: 85,798,511 Q260* probably null Het
Add2 A T 6: 86,098,646 Y259F probably benign Het
Bora T C 14: 99,068,404 V403A probably benign Het
Ccdc144b C T 3: 36,018,997 A379T probably damaging Het
Ccnl1 G A 3: 65,946,770 R477W probably damaging Het
Cdc25a CG CGG 9: 109,879,893 probably null Het
Cdr2l T C 11: 115,393,377 S180P probably damaging Het
Cep290 T A 10: 100,549,329 L1889Q probably damaging Het
Ces4a T C 8: 105,142,821 V208A probably damaging Het
Col2a1 T C 15: 97,979,250 D1049G probably damaging Het
Coro1a A T 7: 126,701,692 N154K possibly damaging Het
Cubn T A 2: 13,469,789 R401S probably benign Het
Cul7 A T 17: 46,663,091 Q1434L probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dars G T 1: 128,373,972 D308E probably benign Het
Dna2 T A 10: 62,961,657 F604I probably damaging Het
Dnah1 T G 14: 31,301,262 I1033L probably benign Het
Dusp27 G A 1: 166,110,259 T77I probably benign Het
Erlin1 T C 19: 44,047,673 E206G probably damaging Het
Esrp2 T A 8: 106,133,273 E345D probably damaging Het
Foxa1 T C 12: 57,542,687 D249G possibly damaging Het
Ghsr C A 3: 27,372,277 L161M probably benign Het
Gm436 T A 4: 144,670,424 K246I possibly damaging Het
Gpr155 C A 2: 73,370,090 V358F probably damaging Het
H2-Eb2 A T 17: 34,334,374 N178I probably damaging Het
Hydin T A 8: 110,410,674 I703N possibly damaging Het
Kctd15 A G 7: 34,641,992 V170A probably damaging Het
Klhl31 A T 9: 77,651,016 Y338F possibly damaging Het
Krt5 C T 15: 101,712,441 A124T probably benign Het
Krt72 T A 15: 101,780,253 I331F probably benign Het
Lrp1b T A 2: 41,511,478 D388V probably damaging Het
Ly9 A G 1: 171,596,507 V382A probably benign Het
Mon2 T C 10: 123,016,396 Y1024C probably damaging Het
Myh14 A G 7: 44,638,394 F572L probably damaging Het
Myh3 A T 11: 67,093,171 D987V probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nphp4 A G 4: 152,562,090 T1360A probably benign Het
Olfr1034 C T 2: 86,047,313 T277I probably damaging Het
Olfr1151 T A 2: 87,857,751 I192K probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Oog4 A G 4: 143,438,001 L320P probably damaging Het
Pcnx2 T C 8: 125,772,086 N1558S probably benign Het
Pde10a A G 17: 8,929,144 E147G probably damaging Het
Pgbd5 T A 8: 124,374,287 H410L probably benign Het
Plce1 A C 19: 38,720,996 D1098A probably damaging Het
Psg25 G A 7: 18,532,003 Q16* probably null Het
Psmd9 T A 5: 123,241,917 V133E probably damaging Het
Rabgap1 C T 2: 37,561,899 S937F probably damaging Het
Rbck1 A G 2: 152,323,170 probably null Het
Rprd2 C G 3: 95,818,739 probably benign Het
Rrs1 A G 1: 9,545,912 N130S probably benign Het
Scmh1 A T 4: 120,515,130 I377F possibly damaging Het
Skor1 G T 9: 63,146,004 R228S probably damaging Het
Slc2a4 A G 11: 69,945,018 V335A probably benign Het
Slc4a9 G A 18: 36,528,371 W62* probably null Het
Taar9 G T 10: 24,109,407 A43D possibly damaging Het
Tns4 T C 11: 99,070,417 Y645C probably damaging Het
Tpcn2 G T 7: 145,277,220 Y129* probably null Het
Trpm3 T C 19: 22,733,024 S278P possibly damaging Het
Ttc3 T C 16: 94,422,297 W615R probably damaging Het
Ttll5 T C 12: 85,863,598 V207A probably damaging Het
Ubr7 G T 12: 102,769,894 M358I probably damaging Het
Vmn2r51 G A 7: 10,105,505 T52I probably benign Het
Vmn2r95 A T 17: 18,452,313 I771F probably benign Het
Wfdc16 T C 2: 164,635,430 S107G probably benign Het
Zmym2 A G 14: 56,902,769 T22A possibly damaging Het
Zmym2 G A 14: 56,914,067 G470R probably damaging Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90753321 critical splice donor site probably null
IGL00915:Urb1 APN 16 90779098 missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90792814 missense probably damaging 1.00
IGL01122:Urb1 APN 16 90804458 missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90757761 missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90777560 missense probably benign 0.11
IGL01606:Urb1 APN 16 90760459 missense probably damaging 1.00
IGL01989:Urb1 APN 16 90769586 splice site probably benign
IGL02516:Urb1 APN 16 90772695 missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90788156 missense probably benign 0.02
IGL03165:Urb1 APN 16 90780304 missense probably damaging 1.00
IGL03216:Urb1 APN 16 90788114 missense probably benign 0.00
H8562:Urb1 UTSW 16 90769469 missense probably benign 0.08
H8786:Urb1 UTSW 16 90769469 missense probably benign 0.08
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0359:Urb1 UTSW 16 90791160 missense probably damaging 1.00
R0386:Urb1 UTSW 16 90796399 missense probably damaging 1.00
R0508:Urb1 UTSW 16 90783262 splice site probably benign
R0517:Urb1 UTSW 16 90777422 nonsense probably null
R0704:Urb1 UTSW 16 90776207 missense probably benign 0.31
R0755:Urb1 UTSW 16 90774094 missense probably damaging 1.00
R0755:Urb1 UTSW 16 90779138 missense probably benign
R0783:Urb1 UTSW 16 90810297 missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90769447 missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90776318 splice site probably null
R1344:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1418:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1453:Urb1 UTSW 16 90796492 missense probably damaging 1.00
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1520:Urb1 UTSW 16 90774745 missense probably benign 0.00
R1521:Urb1 UTSW 16 90753863 missense probably damaging 1.00
R1617:Urb1 UTSW 16 90760452 missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90774048 critical splice donor site probably null
R1640:Urb1 UTSW 16 90772626 missense probably benign 0.00
R1664:Urb1 UTSW 16 90788082 critical splice donor site probably null
R1672:Urb1 UTSW 16 90787397 missense probably damaging 1.00
R1694:Urb1 UTSW 16 90767040 missense probably benign
R1856:Urb1 UTSW 16 90761695 missense probably benign 0.00
R2001:Urb1 UTSW 16 90762344 missense probably benign 0.30
R2196:Urb1 UTSW 16 90774256 missense probably benign 0.01
R2850:Urb1 UTSW 16 90774256 missense probably benign 0.01
R3009:Urb1 UTSW 16 90774798 missense probably benign 0.09
R3104:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3105:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3106:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3160:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3162:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3900:Urb1 UTSW 16 90783376 missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90769465 missense probably damaging 1.00
R4036:Urb1 UTSW 16 90788086 missense probably benign
R4332:Urb1 UTSW 16 90774537 missense probably damaging 1.00
R4448:Urb1 UTSW 16 90769394 missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90788146 missense probably benign 0.04
R4593:Urb1 UTSW 16 90787444 missense probably damaging 1.00
R4610:Urb1 UTSW 16 90776271 missense probably benign 0.43
R4659:Urb1 UTSW 16 90776129 missense probably damaging 0.96
R4672:Urb1 UTSW 16 90772634 missense probably benign
R4681:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R4771:Urb1 UTSW 16 90753518 missense probably benign 0.00
R4790:Urb1 UTSW 16 90769555 nonsense probably null
R4798:Urb1 UTSW 16 90757827 missense probably benign 0.12
R4809:Urb1 UTSW 16 90759842 missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90795414 nonsense probably null
R4916:Urb1 UTSW 16 90783328 missense probably damaging 1.00
R4969:Urb1 UTSW 16 90805411 missense probably damaging 1.00
R5032:Urb1 UTSW 16 90756171 missense probably benign 0.00
R5111:Urb1 UTSW 16 90752017 missense probably benign 0.00
R5122:Urb1 UTSW 16 90752095 nonsense probably null
R5184:Urb1 UTSW 16 90783274 critical splice donor site probably null
R5199:Urb1 UTSW 16 90792748 missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90792762 missense probably damaging 1.00
R5767:Urb1 UTSW 16 90776163 missense probably benign 0.00
R5812:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R5872:Urb1 UTSW 16 90772764 nonsense probably null
R6052:Urb1 UTSW 16 90762383 missense probably damaging 1.00
R6063:Urb1 UTSW 16 90789097 missense probably benign 0.02
R6065:Urb1 UTSW 16 90803332 missense probably benign 0.03
R6181:Urb1 UTSW 16 90779094 missense probably benign 0.00
R6268:Urb1 UTSW 16 90753919 missense probably benign 0.03
R6429:Urb1 UTSW 16 90762430 splice site probably null
R6572:Urb1 UTSW 16 90787414 missense probably benign 0.37
R6606:Urb1 UTSW 16 90810268 missense probably benign 0.00
R6730:Urb1 UTSW 16 90779083 missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90782106 missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90791166 missense probably damaging 1.00
R7238:Urb1 UTSW 16 90752115 missense possibly damaging 0.88
R7339:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7341:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7361:Urb1 UTSW 16 90774768 missense probably damaging 0.99
R7365:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7366:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7440:Urb1 UTSW 16 90787408 missense probably damaging 1.00
R7530:Urb1 UTSW 16 90761634 missense probably damaging 1.00
R7553:Urb1 UTSW 16 90792864 missense probably damaging 1.00
R7557:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7603:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7607:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7609:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7610:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7612:Urb1 UTSW 16 90797910 missense probably damaging 1.00
R7613:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7684:Urb1 UTSW 16 90786118 nonsense probably null
R8029:Urb1 UTSW 16 90779152 missense possibly damaging 0.67
Z1177:Urb1 UTSW 16 90753883 missense probably benign 0.00
Z1177:Urb1 UTSW 16 90774862 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAGACAAGCCTGGACATGCTGC -3'
(R):5'- TTGAGTACAGTGCCACACTGCC -3'

Sequencing Primer
(F):5'- TGGACATGCTGCAATGGC -3'
(R):5'- CATGCTTAGTGTGAAATGCCC -3'
Posted On2014-04-24