Incidental Mutation 'R1598:Cul7'
ID175987
Institutional Source Beutler Lab
Gene Symbol Cul7
Ensembl Gene ENSMUSG00000038545
Gene Namecullin 7
Synonymsp185, 2510004L20Rik, C230011P08Rik, p193
MMRRC Submission 039635-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1598 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46650337-46664364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46663091 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1434 (Q1434L)
Ref Sequence ENSEMBL: ENSMUSP00000049128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024766] [ENSMUST00000043464] [ENSMUST00000133393] [ENSMUST00000145567]
Predicted Effect probably benign
Transcript: ENSMUST00000024766
SMART Domains Protein: ENSMUSP00000024766
Gene: ENSMUSG00000023971

DomainStartEndE-ValueType
Pfam:DUF947 55 219 7.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043464
AA Change: Q1434L

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049128
Gene: ENSMUSG00000038545
AA Change: Q1434L

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 218 229 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 423 5.7e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
low complexity region 603 618 N/A INTRINSIC
low complexity region 635 648 N/A INTRINSIC
APC10 811 973 9.35e-49 SMART
low complexity region 983 993 N/A INTRINSIC
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1301 1318 N/A INTRINSIC
low complexity region 1335 1370 N/A INTRINSIC
Blast:Cullin_Nedd8 1550 1633 1e-41 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125949
Predicted Effect probably benign
Transcript: ENSMUST00000133393
SMART Domains Protein: ENSMUSP00000119393
Gene: ENSMUSG00000038545

DomainStartEndE-ValueType
low complexity region 17 26 N/A INTRINSIC
Pfam:Cul7 51 126 8e-34 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
SCOP:d1gqpa_ 487 568 1e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145567
SMART Domains Protein: ENSMUSP00000116133
Gene: ENSMUSG00000038545

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
SCOP:d1jdha_ 63 222 2e-4 SMART
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 424 9.5e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of an E3 ubiquitin-protein ligase complex. The encoded protein interacts with TP53, CUL9, and FBXW8 proteins. Defects in this gene are a cause of 3M syndrome type 1 (3M1). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: During late gestation, homozygous null fetuses display reduced growth associated with abnormal placental development and hemorrhaging due to vascular defects. Mutant mice are born but die shortly after birth, succumbing to respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik G A 11: 80,364,012 Q328* probably null Het
Adamts1 G A 16: 85,798,511 Q260* probably null Het
Add2 A T 6: 86,098,646 Y259F probably benign Het
Bora T C 14: 99,068,404 V403A probably benign Het
Ccdc144b C T 3: 36,018,997 A379T probably damaging Het
Ccnl1 G A 3: 65,946,770 R477W probably damaging Het
Cdc25a CG CGG 9: 109,879,893 probably null Het
Cdr2l T C 11: 115,393,377 S180P probably damaging Het
Cep290 T A 10: 100,549,329 L1889Q probably damaging Het
Ces4a T C 8: 105,142,821 V208A probably damaging Het
Col2a1 T C 15: 97,979,250 D1049G probably damaging Het
Coro1a A T 7: 126,701,692 N154K possibly damaging Het
Cubn T A 2: 13,469,789 R401S probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dars G T 1: 128,373,972 D308E probably benign Het
Dna2 T A 10: 62,961,657 F604I probably damaging Het
Dnah1 T G 14: 31,301,262 I1033L probably benign Het
Dusp27 G A 1: 166,110,259 T77I probably benign Het
Erlin1 T C 19: 44,047,673 E206G probably damaging Het
Esrp2 T A 8: 106,133,273 E345D probably damaging Het
Foxa1 T C 12: 57,542,687 D249G possibly damaging Het
Ghsr C A 3: 27,372,277 L161M probably benign Het
Gm436 T A 4: 144,670,424 K246I possibly damaging Het
Gpr155 C A 2: 73,370,090 V358F probably damaging Het
H2-Eb2 A T 17: 34,334,374 N178I probably damaging Het
Hydin T A 8: 110,410,674 I703N possibly damaging Het
Kctd15 A G 7: 34,641,992 V170A probably damaging Het
Klhl31 A T 9: 77,651,016 Y338F possibly damaging Het
Krt5 C T 15: 101,712,441 A124T probably benign Het
Krt72 T A 15: 101,780,253 I331F probably benign Het
Lrp1b T A 2: 41,511,478 D388V probably damaging Het
Ly9 A G 1: 171,596,507 V382A probably benign Het
Mon2 T C 10: 123,016,396 Y1024C probably damaging Het
Myh14 A G 7: 44,638,394 F572L probably damaging Het
Myh3 A T 11: 67,093,171 D987V probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nphp4 A G 4: 152,562,090 T1360A probably benign Het
Olfr1034 C T 2: 86,047,313 T277I probably damaging Het
Olfr1151 T A 2: 87,857,751 I192K probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Oog4 A G 4: 143,438,001 L320P probably damaging Het
Pcnx2 T C 8: 125,772,086 N1558S probably benign Het
Pde10a A G 17: 8,929,144 E147G probably damaging Het
Pgbd5 T A 8: 124,374,287 H410L probably benign Het
Plce1 A C 19: 38,720,996 D1098A probably damaging Het
Psg25 G A 7: 18,532,003 Q16* probably null Het
Psmd9 T A 5: 123,241,917 V133E probably damaging Het
Rabgap1 C T 2: 37,561,899 S937F probably damaging Het
Rbck1 A G 2: 152,323,170 probably null Het
Rprd2 C G 3: 95,818,739 probably benign Het
Rrs1 A G 1: 9,545,912 N130S probably benign Het
Scmh1 A T 4: 120,515,130 I377F possibly damaging Het
Skor1 G T 9: 63,146,004 R228S probably damaging Het
Slc2a4 A G 11: 69,945,018 V335A probably benign Het
Slc4a9 G A 18: 36,528,371 W62* probably null Het
Taar9 G T 10: 24,109,407 A43D possibly damaging Het
Tns4 T C 11: 99,070,417 Y645C probably damaging Het
Tpcn2 G T 7: 145,277,220 Y129* probably null Het
Trpm3 T C 19: 22,733,024 S278P possibly damaging Het
Ttc3 T C 16: 94,422,297 W615R probably damaging Het
Ttll5 T C 12: 85,863,598 V207A probably damaging Het
Ubr7 G T 12: 102,769,894 M358I probably damaging Het
Urb1 C A 16: 90,777,440 V918F possibly damaging Het
Vmn2r51 G A 7: 10,105,505 T52I probably benign Het
Vmn2r95 A T 17: 18,452,313 I771F probably benign Het
Wfdc16 T C 2: 164,635,430 S107G probably benign Het
Zmym2 A G 14: 56,902,769 T22A possibly damaging Het
Zmym2 G A 14: 56,914,067 G470R probably damaging Het
Other mutations in Cul7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Cul7 APN 17 46652508 missense probably damaging 1.00
IGL01288:Cul7 APN 17 46657807 splice site probably benign
IGL01669:Cul7 APN 17 46658715 missense possibly damaging 0.94
P0019:Cul7 UTSW 17 46660247 splice site probably benign
PIT4453001:Cul7 UTSW 17 46651820 missense probably damaging 0.99
R0083:Cul7 UTSW 17 46655556 missense probably benign 0.00
R0121:Cul7 UTSW 17 46663373 missense probably damaging 1.00
R0157:Cul7 UTSW 17 46653835 missense possibly damaging 0.93
R0266:Cul7 UTSW 17 46654595 missense probably benign 0.00
R0358:Cul7 UTSW 17 46663744 critical splice donor site probably null
R0544:Cul7 UTSW 17 46663544 missense possibly damaging 0.94
R0565:Cul7 UTSW 17 46652003 missense probably damaging 0.98
R0677:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0696:Cul7 UTSW 17 46659608 missense probably damaging 1.00
R0702:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0735:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0893:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0900:Cul7 UTSW 17 46658337 missense probably benign 0.36
R0975:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0976:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1014:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1016:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1104:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1162:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1378:Cul7 UTSW 17 46662126 missense probably damaging 0.99
R1479:Cul7 UTSW 17 46651747 missense probably damaging 1.00
R1498:Cul7 UTSW 17 46655710 missense probably benign 0.01
R1521:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1542:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1545:Cul7 UTSW 17 46651553 missense probably damaging 1.00
R1600:Cul7 UTSW 17 46651822 nonsense probably null
R1618:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1752:Cul7 UTSW 17 46653167 missense probably benign 0.10
R1881:Cul7 UTSW 17 46651962 missense probably damaging 1.00
R1901:Cul7 UTSW 17 46655740 missense probably damaging 1.00
R1902:Cul7 UTSW 17 46655740 missense probably damaging 1.00
R1913:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R2213:Cul7 UTSW 17 46651472 missense probably damaging 0.99
R2370:Cul7 UTSW 17 46661641 missense probably damaging 1.00
R2929:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2930:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2990:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2992:Cul7 UTSW 17 46651600 missense probably benign 0.00
R4201:Cul7 UTSW 17 46661312 missense probably damaging 1.00
R4792:Cul7 UTSW 17 46657050 nonsense probably null
R4971:Cul7 UTSW 17 46659119 missense probably benign 0.00
R5014:Cul7 UTSW 17 46655942 makesense probably null
R5384:Cul7 UTSW 17 46654477 missense probably benign 0.44
R5957:Cul7 UTSW 17 46657757 missense probably damaging 1.00
R6128:Cul7 UTSW 17 46651662 missense probably damaging 1.00
R6294:Cul7 UTSW 17 46663148 missense probably benign
R6812:Cul7 UTSW 17 46661409 missense probably benign 0.00
R7073:Cul7 UTSW 17 46658731 missense probably damaging 1.00
R7112:Cul7 UTSW 17 46651698 missense probably damaging 1.00
R7246:Cul7 UTSW 17 46662067 missense probably benign 0.04
R7361:Cul7 UTSW 17 46657007 missense probably damaging 1.00
R7567:Cul7 UTSW 17 46654595 missense probably benign 0.00
R7682:Cul7 UTSW 17 46655595 missense probably benign
R7689:Cul7 UTSW 17 46652821 nonsense probably null
R7797:Cul7 UTSW 17 46658642 missense possibly damaging 0.65
R7897:Cul7 UTSW 17 46658005 missense probably benign
R7980:Cul7 UTSW 17 46658005 missense probably benign
Z1177:Cul7 UTSW 17 46652805 frame shift probably null
Z1177:Cul7 UTSW 17 46658738 missense probably damaging 0.99
Z1177:Cul7 UTSW 17 46659569 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCAGAAGCCATCGTGCCCAGAAG -3'
(R):5'- ATTCCTGACTCAGAGCAGTCTGCC -3'

Sequencing Primer
(F):5'- ATCGTGCCCAGAAGTCCTG -3'
(R):5'- TGTTGAGATGCAGCAGCA -3'
Posted On2014-04-24