Incidental Mutation 'R1598:Plce1'
ID175990
Institutional Source Beutler Lab
Gene Symbol Plce1
Ensembl Gene ENSMUSG00000024998
Gene Namephospholipase C, epsilon 1
Synonyms4933403A21Rik, PLCepsilon
MMRRC Submission 039635-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.683) question?
Stock #R1598 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location38481109-38785030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 38720996 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 1098 (D1098A)
Ref Sequence ENSEMBL: ENSMUSP00000138360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169713] [ENSMUST00000182267] [ENSMUST00000182481]
Predicted Effect probably damaging
Transcript: ENSMUST00000169713
AA Change: D1098A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998
AA Change: D1098A

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 7.6e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182267
AA Change: D1098A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138330
Gene: ENSMUSG00000024998
AA Change: D1098A

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 5.9e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1552 1581 N/A INTRINSIC
SCOP:d1qasa3 1648 1676 1e-3 SMART
low complexity region 1680 1694 N/A INTRINSIC
PLCYc 1724 1840 4.28e-46 SMART
C2 1864 1962 3.7e-10 SMART
PDB:2BYE|A 2000 2108 6e-47 PDB
RA 2129 2232 1.12e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182481
AA Change: D1098A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998
AA Change: D1098A

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 8e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182589
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in a congenital semilunar valvulogenesis defect which causes regurgitation and stenosis, and decreased incidence of induced skin tumors. Another mutant exhibits decreased cardiac contraction and increased hypertrophy in response to chronic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik G A 11: 80,364,012 Q328* probably null Het
Adamts1 G A 16: 85,798,511 Q260* probably null Het
Add2 A T 6: 86,098,646 Y259F probably benign Het
Bora T C 14: 99,068,404 V403A probably benign Het
Ccdc144b C T 3: 36,018,997 A379T probably damaging Het
Ccnl1 G A 3: 65,946,770 R477W probably damaging Het
Cdc25a CG CGG 9: 109,879,893 probably null Het
Cdr2l T C 11: 115,393,377 S180P probably damaging Het
Cep290 T A 10: 100,549,329 L1889Q probably damaging Het
Ces4a T C 8: 105,142,821 V208A probably damaging Het
Col2a1 T C 15: 97,979,250 D1049G probably damaging Het
Coro1a A T 7: 126,701,692 N154K possibly damaging Het
Cubn T A 2: 13,469,789 R401S probably benign Het
Cul7 A T 17: 46,663,091 Q1434L probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dars G T 1: 128,373,972 D308E probably benign Het
Dna2 T A 10: 62,961,657 F604I probably damaging Het
Dnah1 T G 14: 31,301,262 I1033L probably benign Het
Dusp27 G A 1: 166,110,259 T77I probably benign Het
Erlin1 T C 19: 44,047,673 E206G probably damaging Het
Esrp2 T A 8: 106,133,273 E345D probably damaging Het
Foxa1 T C 12: 57,542,687 D249G possibly damaging Het
Ghsr C A 3: 27,372,277 L161M probably benign Het
Gm436 T A 4: 144,670,424 K246I possibly damaging Het
Gpr155 C A 2: 73,370,090 V358F probably damaging Het
H2-Eb2 A T 17: 34,334,374 N178I probably damaging Het
Hydin T A 8: 110,410,674 I703N possibly damaging Het
Kctd15 A G 7: 34,641,992 V170A probably damaging Het
Klhl31 A T 9: 77,651,016 Y338F possibly damaging Het
Krt5 C T 15: 101,712,441 A124T probably benign Het
Krt72 T A 15: 101,780,253 I331F probably benign Het
Lrp1b T A 2: 41,511,478 D388V probably damaging Het
Ly9 A G 1: 171,596,507 V382A probably benign Het
Mon2 T C 10: 123,016,396 Y1024C probably damaging Het
Myh14 A G 7: 44,638,394 F572L probably damaging Het
Myh3 A T 11: 67,093,171 D987V probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nphp4 A G 4: 152,562,090 T1360A probably benign Het
Olfr1034 C T 2: 86,047,313 T277I probably damaging Het
Olfr1151 T A 2: 87,857,751 I192K probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Oog4 A G 4: 143,438,001 L320P probably damaging Het
Pcnx2 T C 8: 125,772,086 N1558S probably benign Het
Pde10a A G 17: 8,929,144 E147G probably damaging Het
Pgbd5 T A 8: 124,374,287 H410L probably benign Het
Psg25 G A 7: 18,532,003 Q16* probably null Het
Psmd9 T A 5: 123,241,917 V133E probably damaging Het
Rabgap1 C T 2: 37,561,899 S937F probably damaging Het
Rbck1 A G 2: 152,323,170 probably null Het
Rprd2 C G 3: 95,818,739 probably benign Het
Rrs1 A G 1: 9,545,912 N130S probably benign Het
Scmh1 A T 4: 120,515,130 I377F possibly damaging Het
Skor1 G T 9: 63,146,004 R228S probably damaging Het
Slc2a4 A G 11: 69,945,018 V335A probably benign Het
Slc4a9 G A 18: 36,528,371 W62* probably null Het
Taar9 G T 10: 24,109,407 A43D possibly damaging Het
Tns4 T C 11: 99,070,417 Y645C probably damaging Het
Tpcn2 G T 7: 145,277,220 Y129* probably null Het
Trpm3 T C 19: 22,733,024 S278P possibly damaging Het
Ttc3 T C 16: 94,422,297 W615R probably damaging Het
Ttll5 T C 12: 85,863,598 V207A probably damaging Het
Ubr7 G T 12: 102,769,894 M358I probably damaging Het
Urb1 C A 16: 90,777,440 V918F possibly damaging Het
Vmn2r51 G A 7: 10,105,505 T52I probably benign Het
Vmn2r95 A T 17: 18,452,313 I771F probably benign Het
Wfdc16 T C 2: 164,635,430 S107G probably benign Het
Zmym2 A G 14: 56,902,769 T22A possibly damaging Het
Zmym2 G A 14: 56,914,067 G470R probably damaging Het
Other mutations in Plce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plce1 APN 19 38745788 missense probably damaging 0.99
IGL00336:Plce1 APN 19 38651906 missense probably damaging 1.00
IGL00430:Plce1 APN 19 38725017 missense probably damaging 1.00
IGL00466:Plce1 APN 19 38721029 missense probably damaging 0.99
IGL00477:Plce1 APN 19 38525132 missense probably benign 0.39
IGL00839:Plce1 APN 19 38698562 missense probably damaging 1.00
IGL01292:Plce1 APN 19 38651785 splice site probably benign
IGL01665:Plce1 APN 19 38524887 missense probably benign 0.01
IGL01826:Plce1 APN 19 38739238 splice site probably benign
IGL01833:Plce1 APN 19 38720981 missense probably damaging 1.00
IGL02201:Plce1 APN 19 38769446 splice site probably benign
IGL02276:Plce1 APN 19 38524757 missense probably benign 0.05
IGL02477:Plce1 APN 19 38719553 splice site probably benign
IGL02746:Plce1 APN 19 38698472 missense probably damaging 1.00
Angel_food UTSW 19 38727013 splice site probably benign
Heavenly UTSW 19 38777989 missense probably damaging 1.00
R0058:Plce1 UTSW 19 38525184 missense possibly damaging 0.90
R0058:Plce1 UTSW 19 38525184 missense possibly damaging 0.90
R0064:Plce1 UTSW 19 38780784 critical splice donor site probably null
R0116:Plce1 UTSW 19 38721821 missense probably benign
R0138:Plce1 UTSW 19 38524419 missense possibly damaging 0.49
R0240:Plce1 UTSW 19 38728886 missense probably damaging 0.99
R0240:Plce1 UTSW 19 38728886 missense probably damaging 0.99
R0504:Plce1 UTSW 19 38778021 splice site probably benign
R0506:Plce1 UTSW 19 38760138 missense probably benign 0.04
R0578:Plce1 UTSW 19 38777939 missense probably damaging 1.00
R0645:Plce1 UTSW 19 38777989 missense probably damaging 1.00
R0730:Plce1 UTSW 19 38716691 missense probably damaging 0.98
R0920:Plce1 UTSW 19 38736521 missense probably damaging 1.00
R1223:Plce1 UTSW 19 38702013 missense probably damaging 1.00
R1223:Plce1 UTSW 19 38767226 missense probably damaging 1.00
R1484:Plce1 UTSW 19 38705339 nonsense probably null
R1488:Plce1 UTSW 19 38716803 missense possibly damaging 0.92
R1624:Plce1 UTSW 19 38724775 missense probably damaging 1.00
R1732:Plce1 UTSW 19 38716838 missense possibly damaging 0.56
R1778:Plce1 UTSW 19 38780790 splice site probably benign
R1797:Plce1 UTSW 19 38758948 critical splice donor site probably null
R1872:Plce1 UTSW 19 38760077 missense probably damaging 1.00
R1876:Plce1 UTSW 19 38780623 missense probably damaging 1.00
R1991:Plce1 UTSW 19 38777924 missense probably damaging 1.00
R2080:Plce1 UTSW 19 38727013 splice site probably benign
R2103:Plce1 UTSW 19 38777924 missense probably damaging 1.00
R2376:Plce1 UTSW 19 38777986 missense probably benign 0.02
R2471:Plce1 UTSW 19 38779926 missense probably damaging 1.00
R2511:Plce1 UTSW 19 38760054 missense probably damaging 1.00
R2842:Plce1 UTSW 19 38524283 missense probably damaging 1.00
R3037:Plce1 UTSW 19 38777884 missense probably damaging 0.98
R3104:Plce1 UTSW 19 38620519 missense probably benign 0.00
R3700:Plce1 UTSW 19 38705337 missense probably damaging 1.00
R3750:Plce1 UTSW 19 38777899 missense probably benign
R3753:Plce1 UTSW 19 38651834 missense probably benign 0.09
R4027:Plce1 UTSW 19 38524265 missense probably damaging 1.00
R4057:Plce1 UTSW 19 38760119 missense probably damaging 1.00
R4376:Plce1 UTSW 19 38705447 critical splice donor site probably null
R4433:Plce1 UTSW 19 38767301 missense probably damaging 1.00
R4520:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4521:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4522:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4524:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4650:Plce1 UTSW 19 38524644 missense probably benign 0.30
R4673:Plce1 UTSW 19 38749396 missense possibly damaging 0.51
R4701:Plce1 UTSW 19 38725007 missense probably benign 0.33
R4828:Plce1 UTSW 19 38769499 missense probably damaging 1.00
R5103:Plce1 UTSW 19 38767215 missense probably damaging 1.00
R5112:Plce1 UTSW 19 38651833 missense probably benign 0.00
R5236:Plce1 UTSW 19 38770347 missense probably benign 0.11
R5268:Plce1 UTSW 19 38758835 missense possibly damaging 0.71
R5288:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5384:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5386:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5448:Plce1 UTSW 19 38779917 missense probably damaging 1.00
R5452:Plce1 UTSW 19 38620482 missense probably benign 0.01
R6004:Plce1 UTSW 19 38721871 missense probably damaging 1.00
R6062:Plce1 UTSW 19 38524751 missense probably benign
R6147:Plce1 UTSW 19 38702037 missense probably damaging 1.00
R6247:Plce1 UTSW 19 38745845 missense probably damaging 1.00
R6278:Plce1 UTSW 19 38725051 splice site probably null
R6306:Plce1 UTSW 19 38769465 missense probably damaging 1.00
R6317:Plce1 UTSW 19 38524530 nonsense probably null
R6437:Plce1 UTSW 19 38525132 missense probably benign 0.39
R6522:Plce1 UTSW 19 38748521 unclassified probably null
R7034:Plce1 UTSW 19 38739357 missense probably damaging 1.00
R7036:Plce1 UTSW 19 38739357 missense probably damaging 1.00
R7037:Plce1 UTSW 19 38702017 missense probably damaging 1.00
R7069:Plce1 UTSW 19 38758940 missense probably damaging 1.00
R7180:Plce1 UTSW 19 38779785 missense probably damaging 1.00
R7189:Plce1 UTSW 19 38760137 missense probably damaging 0.97
R7227:Plce1 UTSW 19 38726902 missense probably benign 0.00
R7253:Plce1 UTSW 19 38698508 missense probably damaging 1.00
R7278:Plce1 UTSW 19 38779896 missense possibly damaging 0.58
R7287:Plce1 UTSW 19 38701903 missense probably benign 0.02
R7422:Plce1 UTSW 19 38651885 missense probably damaging 1.00
R7557:Plce1 UTSW 19 38765404 missense probably benign 0.30
R7607:Plce1 UTSW 19 38524752 missense probably benign
R7615:Plce1 UTSW 19 38524665 missense probably benign 0.18
R7653:Plce1 UTSW 19 38749319 missense probably benign 0.20
R7685:Plce1 UTSW 19 38748433 missense probably benign 0.00
R7716:Plce1 UTSW 19 38716851 missense probably benign
X0022:Plce1 UTSW 19 38726999 missense probably damaging 1.00
X0065:Plce1 UTSW 19 38777914 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CTTACTTGGGCAGCCTTACCGTAG -3'
(R):5'- TGGCAAGCCAATGACCATTTTCTTTC -3'

Sequencing Primer
(F):5'- AGCCTTACCGTAGGTTTTTACTG -3'
(R):5'- cccacatcagacacctcac -3'
Posted On2014-04-24