Incidental Mutation 'R1599:Rab3gap2'
ID175999
Institutional Source Beutler Lab
Gene Symbol Rab3gap2
Ensembl Gene ENSMUSG00000039318
Gene NameRAB3 GTPase activating protein subunit 2
Synonyms1110059F07Rik
MMRRC Submission 039636-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1599 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location185204117-185286759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 185251026 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 454 (T454I)
Ref Sequence ENSEMBL: ENSMUSP00000141608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069652] [ENSMUST00000194740]
Predicted Effect probably benign
Transcript: ENSMUST00000069652
AA Change: T454I

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000066325
Gene: ENSMUSG00000039318
AA Change: T454I

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
Pfam:RAB3GAP2_N 73 497 1.3e-167 PFAM
low complexity region 667 686 N/A INTRINSIC
Pfam:RAB3GAP2_C 767 1366 3.2e-245 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193245
Predicted Effect probably benign
Transcript: ENSMUST00000194740
AA Change: T454I

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141608
Gene: ENSMUSG00000039318
AA Change: T454I

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
Pfam:RAB3GAP2_N 73 497 1.3e-157 PFAM
low complexity region 667 686 N/A INTRINSIC
Pfam:RAB3GAP2_C 766 1346 2.5e-233 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RAB3 protein family, members of which are involved in regulated exocytosis of neurotransmitters and hormones. This protein forms the Rab3 GTPase-activating complex with RAB3GAP1, where it constitutes the regulatory subunit, whereas the latter functions as the catalytic subunit. This gene has the highest level of expression in the brain, consistent with it having a key role in neurodevelopment. Mutations in this gene are associated with Martsolf syndrome.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,150,259 E202G probably damaging Het
9230110F15Rik T C 9: 35,839,037 N113S probably benign Het
Adam23 A G 1: 63,570,933 D698G possibly damaging Het
Adam3 T C 8: 24,725,361 D20G possibly damaging Het
Adamts12 T C 15: 11,071,711 S114P probably damaging Het
Adgrg6 T A 10: 14,467,313 R297* probably null Het
Ahdc1 A T 4: 133,064,936 S1163C possibly damaging Het
AI481877 A T 4: 59,072,349 N622K possibly damaging Het
Axl A G 7: 25,763,969 Y619H probably damaging Het
Bcl11a G T 11: 24,163,887 C410F probably damaging Het
Brca2 C A 5: 150,548,713 S2359* probably null Het
Calca A G 7: 114,634,472 S75P probably damaging Het
Ccpg1 T A 9: 72,999,125 Y54* probably null Het
Cfap161 A T 7: 83,776,079 M268K possibly damaging Het
Cfap61 T A 2: 146,012,163 V365E probably benign Het
Cgnl1 T C 9: 71,641,427 I1000V probably benign Het
Chd2 A T 7: 73,473,051 D978E probably benign Het
Ctgf A T 10: 24,597,399 R279W probably benign Het
Cyth1 G A 11: 118,177,221 T297M probably damaging Het
Dennd1b T G 1: 139,167,730 D505E probably benign Het
Dgkd A G 1: 87,881,886 T99A possibly damaging Het
Fam161a A T 11: 23,021,093 M180L probably benign Het
Gar1 G T 3: 129,830,604 R80S probably benign Het
Gm28042 T C 2: 120,036,463 S419P probably benign Het
Gm5591 A C 7: 38,520,370 C360G probably benign Het
Golga2 A G 2: 32,303,173 H427R probably benign Het
Gpt2 A G 8: 85,512,234 Y232C probably damaging Het
Hnrnpll T A 17: 80,053,625 H118L unknown Het
Ice2 T A 9: 69,411,442 C303S probably null Het
Ikzf3 C A 11: 98,467,093 G473C probably damaging Het
Kansl3 A T 1: 36,367,870 D38E probably damaging Het
Kcna6 A T 6: 126,739,319 D202E probably benign Het
Klhl21 G A 4: 152,012,300 G341D probably damaging Het
Klhl29 A T 12: 5,093,538 V497D probably damaging Het
Kmt2b G A 7: 30,570,575 L2449F probably damaging Het
Kmt5c A G 7: 4,741,900 E10G probably damaging Het
Lama3 C T 18: 12,450,400 Q682* probably null Het
Lamb3 T C 1: 193,320,493 V82A probably damaging Het
Larp4b C T 13: 9,122,150 T2I probably damaging Het
Man2a1 T C 17: 64,679,831 Y613H possibly damaging Het
Mcm3 G A 1: 20,820,198 T4I probably benign Het
Mki67 C T 7: 135,699,934 A1124T probably benign Het
Mlh3 A T 12: 85,268,369 L348I probably damaging Het
Mmrn1 G A 6: 60,945,037 M159I probably benign Het
Muc5ac A T 7: 141,798,903 Q709L possibly damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nosip A G 7: 45,074,006 N32S probably benign Het
Npat T C 9: 53,562,404 Y499H possibly damaging Het
Nt5c1b T A 12: 10,390,024 I522N probably damaging Het
Olfr347 G T 2: 36,734,989 V223F probably benign Het
Olfr457 T A 6: 42,471,242 K312M probably damaging Het
Olfr653 A G 7: 104,579,648 M1V probably null Het
Olfr850 T A 9: 19,478,221 T7S probably damaging Het
Pappa2 A G 1: 158,857,172 F799S probably damaging Het
Pcdha1 C T 18: 37,185,237 T941M probably damaging Het
Pilrb2 A T 5: 137,868,597 F215I possibly damaging Het
Pkd1l3 G T 8: 109,636,384 M1092I probably benign Het
Ppp1r21 G T 17: 88,572,627 V491L probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prr27 G T 5: 87,843,225 R232L probably benign Het
Rgs11 C A 17: 26,208,249 H385N probably damaging Het
S1pr5 T A 9: 21,243,934 T399S probably benign Het
Sacs G A 14: 61,203,638 M1044I probably benign Het
Sec31b T A 19: 44,523,153 Q603L possibly damaging Het
Setx G A 2: 29,140,373 E275K probably benign Het
Sh3tc1 G A 5: 35,707,512 P444S probably benign Het
Strn3 T A 12: 51,652,766 N208Y possibly damaging Het
Tmem87a T C 2: 120,394,387 N131S probably damaging Het
Tmprss13 T A 9: 45,338,318 W318R probably damaging Het
Trabd2b T C 4: 114,408,981 V64A probably damaging Het
Trafd1 A T 5: 121,379,657 N24K probably damaging Het
Ttc41 T C 10: 86,776,573 S1237P probably benign Het
Ttll1 A G 15: 83,497,354 V238A probably benign Het
Vps50 T C 6: 3,565,537 S492P probably benign Het
Zic1 T C 9: 91,361,688 I409V probably benign Het
Other mutations in Rab3gap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Rab3gap2 APN 1 185238870 missense probably damaging 1.00
IGL01620:Rab3gap2 APN 1 185204326 missense probably benign
IGL01977:Rab3gap2 APN 1 185267023 nonsense probably null
IGL02183:Rab3gap2 APN 1 185271468 nonsense probably null
IGL02229:Rab3gap2 APN 1 185259383 missense possibly damaging 0.71
IGL02231:Rab3gap2 APN 1 185266898 splice site probably benign
IGL02506:Rab3gap2 APN 1 185252024 splice site probably benign
IGL02618:Rab3gap2 APN 1 185251741 missense possibly damaging 0.79
IGL02643:Rab3gap2 APN 1 185267000 missense possibly damaging 0.69
IGL03239:Rab3gap2 APN 1 185249894 missense probably damaging 1.00
PIT4498001:Rab3gap2 UTSW 1 185281685 missense probably damaging 1.00
R0173:Rab3gap2 UTSW 1 185249907 missense possibly damaging 0.51
R0372:Rab3gap2 UTSW 1 185262694 missense possibly damaging 0.93
R0492:Rab3gap2 UTSW 1 185252392 splice site probably benign
R0510:Rab3gap2 UTSW 1 185260508 splice site probably benign
R0708:Rab3gap2 UTSW 1 185249926 missense probably damaging 0.99
R0711:Rab3gap2 UTSW 1 185249926 missense probably damaging 0.99
R1135:Rab3gap2 UTSW 1 185275943 missense possibly damaging 0.95
R1428:Rab3gap2 UTSW 1 185247904 missense probably damaging 1.00
R1758:Rab3gap2 UTSW 1 185283884 missense probably benign 0.13
R1903:Rab3gap2 UTSW 1 185221902 missense probably benign
R1929:Rab3gap2 UTSW 1 185283542 critical splice donor site probably null
R1994:Rab3gap2 UTSW 1 185236024 missense probably damaging 1.00
R2010:Rab3gap2 UTSW 1 185278281 missense possibly damaging 0.57
R2102:Rab3gap2 UTSW 1 185282389 missense probably benign 0.00
R2120:Rab3gap2 UTSW 1 185261367 missense possibly damaging 0.95
R2219:Rab3gap2 UTSW 1 185275916 missense probably damaging 0.99
R2259:Rab3gap2 UTSW 1 185221859 missense probably damaging 1.00
R2270:Rab3gap2 UTSW 1 185283542 critical splice donor site probably null
R2272:Rab3gap2 UTSW 1 185283542 critical splice donor site probably null
R3083:Rab3gap2 UTSW 1 185204269 missense probably benign 0.00
R3776:Rab3gap2 UTSW 1 185277205 missense probably damaging 1.00
R4050:Rab3gap2 UTSW 1 185272643 critical splice donor site probably null
R4130:Rab3gap2 UTSW 1 185204297 missense possibly damaging 0.51
R4176:Rab3gap2 UTSW 1 185246666 missense probably damaging 0.99
R4296:Rab3gap2 UTSW 1 185255837 critical splice donor site probably null
R4416:Rab3gap2 UTSW 1 185282347 missense probably benign 0.00
R4426:Rab3gap2 UTSW 1 185235342 missense probably damaging 1.00
R4516:Rab3gap2 UTSW 1 185267068 missense probably benign
R4518:Rab3gap2 UTSW 1 185267068 missense probably benign
R4891:Rab3gap2 UTSW 1 185259366 missense probably benign 0.00
R4913:Rab3gap2 UTSW 1 185262829 missense probably benign 0.12
R4955:Rab3gap2 UTSW 1 185267155 intron probably benign
R5411:Rab3gap2 UTSW 1 185277145 critical splice acceptor site probably null
R5516:Rab3gap2 UTSW 1 185235487 missense probably benign 0.02
R5670:Rab3gap2 UTSW 1 185221899 missense probably benign
R5670:Rab3gap2 UTSW 1 185277205 missense probably damaging 1.00
R6380:Rab3gap2 UTSW 1 185235984 missense probably damaging 1.00
R6533:Rab3gap2 UTSW 1 185232954 splice site probably null
R6655:Rab3gap2 UTSW 1 185250011 missense probably damaging 1.00
R6676:Rab3gap2 UTSW 1 185283410 missense probably damaging 1.00
R6726:Rab3gap2 UTSW 1 185247865 missense probably damaging 0.99
R6969:Rab3gap2 UTSW 1 185236012 missense probably damaging 1.00
R7151:Rab3gap2 UTSW 1 185248053 missense probably benign 0.00
R7168:Rab3gap2 UTSW 1 185204297 missense possibly damaging 0.51
R7196:Rab3gap2 UTSW 1 185281667 missense probably damaging 1.00
R7201:Rab3gap2 UTSW 1 185267191 missense probably damaging 1.00
R7371:Rab3gap2 UTSW 1 185251068 missense probably damaging 1.00
R7573:Rab3gap2 UTSW 1 185282382 missense probably benign
R7779:Rab3gap2 UTSW 1 185259444 missense probably damaging 0.98
R7913:Rab3gap2 UTSW 1 185262816 missense possibly damaging 0.88
R7922:Rab3gap2 UTSW 1 185249920 missense probably benign 0.00
R8115:Rab3gap2 UTSW 1 185267250 missense possibly damaging 0.90
R8203:Rab3gap2 UTSW 1 185267179 missense probably damaging 1.00
R8242:Rab3gap2 UTSW 1 185221853 missense probably benign
R8322:Rab3gap2 UTSW 1 185246680 missense probably benign 0.42
R8360:Rab3gap2 UTSW 1 185267073 intron probably benign
R8515:Rab3gap2 UTSW 1 185262820 missense probably benign 0.15
Z1088:Rab3gap2 UTSW 1 185281677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACCTACTGTTGAGCCCAGATG -3'
(R):5'- GCTAGAGCAAACTCACGGAAGTCAG -3'

Sequencing Primer
(F):5'- CTGTTGAGCCCAGATGAATAAACTG -3'
(R):5'- CATGATCCTCAAGTCTATGTCAGG -3'
Posted On2014-04-24