Incidental Mutation 'R1599:Olfr457'
ID176021
Institutional Source Beutler Lab
Gene Symbol Olfr457
Ensembl Gene ENSMUSG00000091983
Gene Nameolfactory receptor 457
SynonymsMOR257-1, GA_x6K02T2P3E9-5088893-5089834
MMRRC Submission 039636-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R1599 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42468015-42476335 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42471242 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 312 (K312M)
Ref Sequence ENSEMBL: ENSMUSP00000144914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170504] [ENSMUST00000203396] [ENSMUST00000204324]
Predicted Effect probably damaging
Transcript: ENSMUST00000170504
AA Change: K312M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127348
Gene: ENSMUSG00000091983
AA Change: K312M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.4e-53 PFAM
Pfam:7tm_1 41 290 2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203396
AA Change: K312M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145162
Gene: ENSMUSG00000091983
AA Change: K312M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.4e-53 PFAM
Pfam:7tm_1 41 290 2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204324
AA Change: K312M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144914
Gene: ENSMUSG00000091983
AA Change: K312M

DomainStartEndE-ValueType
Pfam:7tm_4 31 125 2.4e-19 PFAM
Pfam:7tm_1 41 125 3.1e-14 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,150,259 E202G probably damaging Het
9230110F15Rik T C 9: 35,839,037 N113S probably benign Het
Adam23 A G 1: 63,570,933 D698G possibly damaging Het
Adam3 T C 8: 24,725,361 D20G possibly damaging Het
Adamts12 T C 15: 11,071,711 S114P probably damaging Het
Adgrg6 T A 10: 14,467,313 R297* probably null Het
Ahdc1 A T 4: 133,064,936 S1163C possibly damaging Het
AI481877 A T 4: 59,072,349 N622K possibly damaging Het
Axl A G 7: 25,763,969 Y619H probably damaging Het
Bcl11a G T 11: 24,163,887 C410F probably damaging Het
Brca2 C A 5: 150,548,713 S2359* probably null Het
Calca A G 7: 114,634,472 S75P probably damaging Het
Ccpg1 T A 9: 72,999,125 Y54* probably null Het
Cfap161 A T 7: 83,776,079 M268K possibly damaging Het
Cfap61 T A 2: 146,012,163 V365E probably benign Het
Cgnl1 T C 9: 71,641,427 I1000V probably benign Het
Chd2 A T 7: 73,473,051 D978E probably benign Het
Ctgf A T 10: 24,597,399 R279W probably benign Het
Cyth1 G A 11: 118,177,221 T297M probably damaging Het
Dennd1b T G 1: 139,167,730 D505E probably benign Het
Dgkd A G 1: 87,881,886 T99A possibly damaging Het
Fam161a A T 11: 23,021,093 M180L probably benign Het
Gar1 G T 3: 129,830,604 R80S probably benign Het
Gm28042 T C 2: 120,036,463 S419P probably benign Het
Gm5591 A C 7: 38,520,370 C360G probably benign Het
Golga2 A G 2: 32,303,173 H427R probably benign Het
Gpt2 A G 8: 85,512,234 Y232C probably damaging Het
Hnrnpll T A 17: 80,053,625 H118L unknown Het
Ice2 T A 9: 69,411,442 C303S probably null Het
Ikzf3 C A 11: 98,467,093 G473C probably damaging Het
Kansl3 A T 1: 36,367,870 D38E probably damaging Het
Kcna6 A T 6: 126,739,319 D202E probably benign Het
Klhl21 G A 4: 152,012,300 G341D probably damaging Het
Klhl29 A T 12: 5,093,538 V497D probably damaging Het
Kmt2b G A 7: 30,570,575 L2449F probably damaging Het
Kmt5c A G 7: 4,741,900 E10G probably damaging Het
Lama3 C T 18: 12,450,400 Q682* probably null Het
Lamb3 T C 1: 193,320,493 V82A probably damaging Het
Larp4b C T 13: 9,122,150 T2I probably damaging Het
Man2a1 T C 17: 64,679,831 Y613H possibly damaging Het
Mcm3 G A 1: 20,820,198 T4I probably benign Het
Mki67 C T 7: 135,699,934 A1124T probably benign Het
Mlh3 A T 12: 85,268,369 L348I probably damaging Het
Mmrn1 G A 6: 60,945,037 M159I probably benign Het
Muc5ac A T 7: 141,798,903 Q709L possibly damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nosip A G 7: 45,074,006 N32S probably benign Het
Npat T C 9: 53,562,404 Y499H possibly damaging Het
Nt5c1b T A 12: 10,390,024 I522N probably damaging Het
Olfr347 G T 2: 36,734,989 V223F probably benign Het
Olfr653 A G 7: 104,579,648 M1V probably null Het
Olfr850 T A 9: 19,478,221 T7S probably damaging Het
Pappa2 A G 1: 158,857,172 F799S probably damaging Het
Pcdha1 C T 18: 37,185,237 T941M probably damaging Het
Pilrb2 A T 5: 137,868,597 F215I possibly damaging Het
Pkd1l3 G T 8: 109,636,384 M1092I probably benign Het
Ppp1r21 G T 17: 88,572,627 V491L probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prr27 G T 5: 87,843,225 R232L probably benign Het
Rab3gap2 C T 1: 185,251,026 T454I probably benign Het
Rgs11 C A 17: 26,208,249 H385N probably damaging Het
S1pr5 T A 9: 21,243,934 T399S probably benign Het
Sacs G A 14: 61,203,638 M1044I probably benign Het
Sec31b T A 19: 44,523,153 Q603L possibly damaging Het
Setx G A 2: 29,140,373 E275K probably benign Het
Sh3tc1 G A 5: 35,707,512 P444S probably benign Het
Strn3 T A 12: 51,652,766 N208Y possibly damaging Het
Tmem87a T C 2: 120,394,387 N131S probably damaging Het
Tmprss13 T A 9: 45,338,318 W318R probably damaging Het
Trabd2b T C 4: 114,408,981 V64A probably damaging Het
Trafd1 A T 5: 121,379,657 N24K probably damaging Het
Ttc41 T C 10: 86,776,573 S1237P probably benign Het
Ttll1 A G 15: 83,497,354 V238A probably benign Het
Vps50 T C 6: 3,565,537 S492P probably benign Het
Zic1 T C 9: 91,361,688 I409V probably benign Het
Other mutations in Olfr457
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Olfr457 APN 6 42472112 missense probably benign 0.00
IGL01915:Olfr457 APN 6 42471289 missense probably benign 0.01
IGL02006:Olfr457 APN 6 42472091 missense probably benign 0.37
IGL02440:Olfr457 APN 6 42472166 missense probably benign
R0024:Olfr457 UTSW 6 42471260 missense probably benign
R0662:Olfr457 UTSW 6 42471774 missense possibly damaging 0.75
R2087:Olfr457 UTSW 6 42472051 missense probably damaging 1.00
R5002:Olfr457 UTSW 6 42471972 missense probably benign 0.18
R5022:Olfr457 UTSW 6 42471287 missense possibly damaging 0.92
R5288:Olfr457 UTSW 6 42471252 missense probably benign
R5342:Olfr457 UTSW 6 42471902 missense probably damaging 1.00
R5823:Olfr457 UTSW 6 42471972 missense probably benign 0.18
R5824:Olfr457 UTSW 6 42471972 missense probably benign 0.18
R6378:Olfr457 UTSW 6 42471753 missense probably benign 0.01
R7384:Olfr457 UTSW 6 42471323 missense possibly damaging 0.89
R7442:Olfr457 UTSW 6 42471500 missense probably benign 0.02
R7631:Olfr457 UTSW 6 42471936 missense probably benign 0.01
X0017:Olfr457 UTSW 6 42471818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATGGCTCATACCCCAGGAGTG -3'
(R):5'- GTTAGACTGGCCTGTGTGGACATC -3'

Sequencing Primer
(F):5'- GGCCAGCATTGGAAAATTAAAG -3'
(R):5'- CAAAGCCTTTGAGACCTGTG -3'
Posted On2014-04-24