Incidental Mutation 'R1599:Axl'
ID176026
Institutional Source Beutler Lab
Gene Symbol Axl
Ensembl Gene ENSMUSG00000002602
Gene NameAXL receptor tyrosine kinase
SynonymsTyro7, Ufo, Ark
MMRRC Submission 039636-MU
Accession Numbers

Genbank: NM_009465; MGI: 1347244

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1599 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25757273-25788705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25763969 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 619 (Y619H)
Ref Sequence ENSEMBL: ENSMUSP00000083110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002677] [ENSMUST00000085948]
Predicted Effect probably damaging
Transcript: ENSMUST00000002677
AA Change: Y628H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002677
Gene: ENSMUSG00000002602
AA Change: Y628H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 35 124 5.53e-6 SMART
IG 139 218 9.06e-2 SMART
FN3 219 312 9.25e-6 SMART
FN3 328 409 2.18e-2 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
TyrKc 530 797 1.91e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085948
AA Change: Y619H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083110
Gene: ENSMUSG00000002602
AA Change: Y619H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 35 124 5.53e-6 SMART
IG 139 218 9.06e-2 SMART
FN3 219 312 9.25e-6 SMART
FN3 328 409 2.18e-2 SMART
transmembrane domain 435 457 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
TyrKc 521 788 1.91e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124442
Predicted Effect probably benign
Transcript: ENSMUST00000132038
SMART Domains Protein: ENSMUSP00000114907
Gene: ENSMUSG00000002602

DomainStartEndE-ValueType
Blast:FN3 2 42 8e-20 BLAST
SCOP:d1gh7a2 2 61 4e-7 SMART
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
Pfam:Pkinase_Tyr 154 188 4.1e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137211
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant mice are phenotypically normal, however in conjunction with mutations in other related receptor tyrosine kinases, mutations of this gene results in fertility defects, autoimmunity abnormalities, and aberrant apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,150,259 E202G probably damaging Het
9230110F15Rik T C 9: 35,839,037 N113S probably benign Het
Adam23 A G 1: 63,570,933 D698G possibly damaging Het
Adam3 T C 8: 24,725,361 D20G possibly damaging Het
Adamts12 T C 15: 11,071,711 S114P probably damaging Het
Adgrg6 T A 10: 14,467,313 R297* probably null Het
Ahdc1 A T 4: 133,064,936 S1163C possibly damaging Het
AI481877 A T 4: 59,072,349 N622K possibly damaging Het
Bcl11a G T 11: 24,163,887 C410F probably damaging Het
Brca2 C A 5: 150,548,713 S2359* probably null Het
Calca A G 7: 114,634,472 S75P probably damaging Het
Ccpg1 T A 9: 72,999,125 Y54* probably null Het
Cfap161 A T 7: 83,776,079 M268K possibly damaging Het
Cfap61 T A 2: 146,012,163 V365E probably benign Het
Cgnl1 T C 9: 71,641,427 I1000V probably benign Het
Chd2 A T 7: 73,473,051 D978E probably benign Het
Ctgf A T 10: 24,597,399 R279W probably benign Het
Cyth1 G A 11: 118,177,221 T297M probably damaging Het
Dennd1b T G 1: 139,167,730 D505E probably benign Het
Dgkd A G 1: 87,881,886 T99A possibly damaging Het
Fam161a A T 11: 23,021,093 M180L probably benign Het
Gar1 G T 3: 129,830,604 R80S probably benign Het
Gm28042 T C 2: 120,036,463 S419P probably benign Het
Gm5591 A C 7: 38,520,370 C360G probably benign Het
Golga2 A G 2: 32,303,173 H427R probably benign Het
Gpt2 A G 8: 85,512,234 Y232C probably damaging Het
Hnrnpll T A 17: 80,053,625 H118L unknown Het
Ice2 T A 9: 69,411,442 C303S probably null Het
Ikzf3 C A 11: 98,467,093 G473C probably damaging Het
Kansl3 A T 1: 36,367,870 D38E probably damaging Het
Kcna6 A T 6: 126,739,319 D202E probably benign Het
Klhl21 G A 4: 152,012,300 G341D probably damaging Het
Klhl29 A T 12: 5,093,538 V497D probably damaging Het
Kmt2b G A 7: 30,570,575 L2449F probably damaging Het
Kmt5c A G 7: 4,741,900 E10G probably damaging Het
Lama3 C T 18: 12,450,400 Q682* probably null Het
Lamb3 T C 1: 193,320,493 V82A probably damaging Het
Larp4b C T 13: 9,122,150 T2I probably damaging Het
Man2a1 T C 17: 64,679,831 Y613H possibly damaging Het
Mcm3 G A 1: 20,820,198 T4I probably benign Het
Mki67 C T 7: 135,699,934 A1124T probably benign Het
Mlh3 A T 12: 85,268,369 L348I probably damaging Het
Mmrn1 G A 6: 60,945,037 M159I probably benign Het
Muc5ac A T 7: 141,798,903 Q709L possibly damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nosip A G 7: 45,074,006 N32S probably benign Het
Npat T C 9: 53,562,404 Y499H possibly damaging Het
Nt5c1b T A 12: 10,390,024 I522N probably damaging Het
Olfr347 G T 2: 36,734,989 V223F probably benign Het
Olfr457 T A 6: 42,471,242 K312M probably damaging Het
Olfr653 A G 7: 104,579,648 M1V probably null Het
Olfr850 T A 9: 19,478,221 T7S probably damaging Het
Pappa2 A G 1: 158,857,172 F799S probably damaging Het
Pcdha1 C T 18: 37,185,237 T941M probably damaging Het
Pilrb2 A T 5: 137,868,597 F215I possibly damaging Het
Pkd1l3 G T 8: 109,636,384 M1092I probably benign Het
Ppp1r21 G T 17: 88,572,627 V491L probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prr27 G T 5: 87,843,225 R232L probably benign Het
Rab3gap2 C T 1: 185,251,026 T454I probably benign Het
Rgs11 C A 17: 26,208,249 H385N probably damaging Het
S1pr5 T A 9: 21,243,934 T399S probably benign Het
Sacs G A 14: 61,203,638 M1044I probably benign Het
Sec31b T A 19: 44,523,153 Q603L possibly damaging Het
Setx G A 2: 29,140,373 E275K probably benign Het
Sh3tc1 G A 5: 35,707,512 P444S probably benign Het
Strn3 T A 12: 51,652,766 N208Y possibly damaging Het
Tmem87a T C 2: 120,394,387 N131S probably damaging Het
Tmprss13 T A 9: 45,338,318 W318R probably damaging Het
Trabd2b T C 4: 114,408,981 V64A probably damaging Het
Trafd1 A T 5: 121,379,657 N24K probably damaging Het
Ttc41 T C 10: 86,776,573 S1237P probably benign Het
Ttll1 A G 15: 83,497,354 V238A probably benign Het
Vps50 T C 6: 3,565,537 S492P probably benign Het
Zic1 T C 9: 91,361,688 I409V probably benign Het
Other mutations in Axl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Axl APN 7 25785899 missense probably benign 0.16
IGL00428:Axl APN 7 25760872 missense probably damaging 1.00
IGL00725:Axl APN 7 25764483 missense probably damaging 0.97
IGL01348:Axl APN 7 25763309 missense probably damaging 1.00
IGL01350:Axl APN 7 25758750 missense probably damaging 1.00
IGL01357:Axl APN 7 25774169 missense probably benign 0.00
IGL02314:Axl APN 7 25786920 missense possibly damaging 0.50
IGL02321:Axl APN 7 25758769 missense probably damaging 1.00
IGL02839:Axl APN 7 25766791 critical splice donor site probably null
IGL02878:Axl APN 7 25758877 missense probably damaging 0.99
R0125:Axl UTSW 7 25786943 missense probably benign 0.00
R0529:Axl UTSW 7 25787287 splice site probably benign
R0539:Axl UTSW 7 25778717 unclassified probably benign
R0614:Axl UTSW 7 25774163 missense probably benign 0.18
R0747:Axl UTSW 7 25764059 missense possibly damaging 0.95
R1727:Axl UTSW 7 25760766 missense possibly damaging 0.68
R1880:Axl UTSW 7 25774548 missense probably damaging 1.00
R2206:Axl UTSW 7 25770636 missense probably damaging 1.00
R2513:Axl UTSW 7 25787516 missense probably benign
R2877:Axl UTSW 7 25766524 missense probably damaging 0.96
R3802:Axl UTSW 7 25788477 start codon destroyed probably null 0.98
R3915:Axl UTSW 7 25760744 splice site probably benign
R4064:Axl UTSW 7 25764020 missense probably benign 0.36
R4072:Axl UTSW 7 25763911 unclassified probably benign
R4073:Axl UTSW 7 25763911 unclassified probably benign
R4074:Axl UTSW 7 25763911 unclassified probably benign
R4378:Axl UTSW 7 25758837 missense probably benign 0.06
R5039:Axl UTSW 7 25785915 missense probably damaging 1.00
R5224:Axl UTSW 7 25786944 missense probably benign 0.00
R5328:Axl UTSW 7 25773411 missense probably damaging 1.00
R5519:Axl UTSW 7 25778662 missense possibly damaging 0.93
R5885:Axl UTSW 7 25766852 missense probably damaging 1.00
R6367:Axl UTSW 7 25787433 missense probably damaging 1.00
R6447:Axl UTSW 7 25770283 missense probably damaging 0.96
R6931:Axl UTSW 7 25761433 missense probably damaging 1.00
R7172:Axl UTSW 7 25786974 missense probably benign 0.33
R7355:Axl UTSW 7 25774106 missense probably benign 0.22
R7410:Axl UTSW 7 25758783 missense probably benign 0.06
X0027:Axl UTSW 7 25770268 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATCTCGAAGTATCTCCCCAGTC -3'
(R):5'- AACTTGGAATGCGACCCCTGAC -3'

Sequencing Primer
(F):5'- gccaccttatcgttcttctctc -3'
(R):5'- CCTGTTCCCAGAAATAGCTGAGG -3'
Posted On2014-04-24