Incidental Mutation 'R1599:Adamts12'
ID176069
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12
SynonymsAI605170; ADAMTS-12
MMRRC Submission 039636-MU
Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R1599 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location11064790-11349231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11071711 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 114 (S114P)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
Predicted Effect probably damaging
Transcript: ENSMUST00000061318
AA Change: S114P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: S114P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228940
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,150,259 E202G probably damaging Het
9230110F15Rik T C 9: 35,839,037 N113S probably benign Het
Adam23 A G 1: 63,570,933 D698G possibly damaging Het
Adam3 T C 8: 24,725,361 D20G possibly damaging Het
Adgrg6 T A 10: 14,467,313 R297* probably null Het
Ahdc1 A T 4: 133,064,936 S1163C possibly damaging Het
AI481877 A T 4: 59,072,349 N622K possibly damaging Het
Axl A G 7: 25,763,969 Y619H probably damaging Het
Bcl11a G T 11: 24,163,887 C410F probably damaging Het
Brca2 C A 5: 150,548,713 S2359* probably null Het
Calca A G 7: 114,634,472 S75P probably damaging Het
Ccpg1 T A 9: 72,999,125 Y54* probably null Het
Cfap161 A T 7: 83,776,079 M268K possibly damaging Het
Cfap61 T A 2: 146,012,163 V365E probably benign Het
Cgnl1 T C 9: 71,641,427 I1000V probably benign Het
Chd2 A T 7: 73,473,051 D978E probably benign Het
Ctgf A T 10: 24,597,399 R279W probably benign Het
Cyth1 G A 11: 118,177,221 T297M probably damaging Het
Dennd1b T G 1: 139,167,730 D505E probably benign Het
Dgkd A G 1: 87,881,886 T99A possibly damaging Het
Fam161a A T 11: 23,021,093 M180L probably benign Het
Gar1 G T 3: 129,830,604 R80S probably benign Het
Gm28042 T C 2: 120,036,463 S419P probably benign Het
Gm5591 A C 7: 38,520,370 C360G probably benign Het
Golga2 A G 2: 32,303,173 H427R probably benign Het
Gpt2 A G 8: 85,512,234 Y232C probably damaging Het
Hnrnpll T A 17: 80,053,625 H118L unknown Het
Ice2 T A 9: 69,411,442 C303S probably null Het
Ikzf3 C A 11: 98,467,093 G473C probably damaging Het
Kansl3 A T 1: 36,367,870 D38E probably damaging Het
Kcna6 A T 6: 126,739,319 D202E probably benign Het
Klhl21 G A 4: 152,012,300 G341D probably damaging Het
Klhl29 A T 12: 5,093,538 V497D probably damaging Het
Kmt2b G A 7: 30,570,575 L2449F probably damaging Het
Kmt5c A G 7: 4,741,900 E10G probably damaging Het
Lama3 C T 18: 12,450,400 Q682* probably null Het
Lamb3 T C 1: 193,320,493 V82A probably damaging Het
Larp4b C T 13: 9,122,150 T2I probably damaging Het
Man2a1 T C 17: 64,679,831 Y613H possibly damaging Het
Mcm3 G A 1: 20,820,198 T4I probably benign Het
Mki67 C T 7: 135,699,934 A1124T probably benign Het
Mlh3 A T 12: 85,268,369 L348I probably damaging Het
Mmrn1 G A 6: 60,945,037 M159I probably benign Het
Muc5ac A T 7: 141,798,903 Q709L possibly damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nosip A G 7: 45,074,006 N32S probably benign Het
Npat T C 9: 53,562,404 Y499H possibly damaging Het
Nt5c1b T A 12: 10,390,024 I522N probably damaging Het
Olfr347 G T 2: 36,734,989 V223F probably benign Het
Olfr457 T A 6: 42,471,242 K312M probably damaging Het
Olfr653 A G 7: 104,579,648 M1V probably null Het
Olfr850 T A 9: 19,478,221 T7S probably damaging Het
Pappa2 A G 1: 158,857,172 F799S probably damaging Het
Pcdha1 C T 18: 37,185,237 T941M probably damaging Het
Pilrb2 A T 5: 137,868,597 F215I possibly damaging Het
Pkd1l3 G T 8: 109,636,384 M1092I probably benign Het
Ppp1r21 G T 17: 88,572,627 V491L probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prr27 G T 5: 87,843,225 R232L probably benign Het
Rab3gap2 C T 1: 185,251,026 T454I probably benign Het
Rgs11 C A 17: 26,208,249 H385N probably damaging Het
S1pr5 T A 9: 21,243,934 T399S probably benign Het
Sacs G A 14: 61,203,638 M1044I probably benign Het
Sec31b T A 19: 44,523,153 Q603L possibly damaging Het
Setx G A 2: 29,140,373 E275K probably benign Het
Sh3tc1 G A 5: 35,707,512 P444S probably benign Het
Strn3 T A 12: 51,652,766 N208Y possibly damaging Het
Tmem87a T C 2: 120,394,387 N131S probably damaging Het
Tmprss13 T A 9: 45,338,318 W318R probably damaging Het
Trabd2b T C 4: 114,408,981 V64A probably damaging Het
Trafd1 A T 5: 121,379,657 N24K probably damaging Het
Ttc41 T C 10: 86,776,573 S1237P probably benign Het
Ttll1 A G 15: 83,497,354 V238A probably benign Het
Vps50 T C 6: 3,565,537 S492P probably benign Het
Zic1 T C 9: 91,361,688 I409V probably benign Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11311599 missense probably benign 0.00
IGL00513:Adamts12 APN 15 11256961 missense probably benign 0.28
IGL00579:Adamts12 APN 15 11152014 missense probably benign 0.20
IGL00984:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL01307:Adamts12 APN 15 11237546 missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11071853 missense probably benign 0.30
IGL01353:Adamts12 APN 15 11292005 splice site probably benign
IGL01373:Adamts12 APN 15 11310730 missense probably benign 0.00
IGL01522:Adamts12 APN 15 11065159 critical splice donor site probably null
IGL01589:Adamts12 APN 15 11311237 missense probably benign 0.26
IGL01715:Adamts12 APN 15 11258096 missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11258183 missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11345594 missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL02216:Adamts12 APN 15 11241485 missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11311015 missense probably benign 0.01
IGL02336:Adamts12 APN 15 11311245 missense probably benign 0.02
IGL02445:Adamts12 APN 15 11286712 missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11263336 missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11345564 missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11292082 missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11241488 missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11071808 missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11286810 missense probably benign 0.33
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0122:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11071508 missense probably benign 0.11
R0308:Adamts12 UTSW 15 11311560 missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11311058 missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11255683 missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11277458 critical splice donor site probably null
R1173:Adamts12 UTSW 15 11071757 missense probably benign
R1174:Adamts12 UTSW 15 11071757 missense probably benign
R1319:Adamts12 UTSW 15 11286791 missense probably benign 0.02
R1344:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11256894 splice site probably benign
R1396:Adamts12 UTSW 15 11311472 missense probably benign 0.01
R1418:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11263361 missense probably benign 0.42
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1700:Adamts12 UTSW 15 11152057 missense probably benign 0.00
R1748:Adamts12 UTSW 15 11241462 missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11071520 missense probably benign 0.06
R1870:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1871:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1872:Adamts12 UTSW 15 11217880 nonsense probably null
R1931:Adamts12 UTSW 15 11270599 missense probably benign 0.00
R2041:Adamts12 UTSW 15 11215735 missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11215735 missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11065088 missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11286083 missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11071754 missense probably benign
R4666:Adamts12 UTSW 15 11311492 missense probably benign 0.08
R4731:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11285901 missense probably benign 0.03
R4877:Adamts12 UTSW 15 11327701 missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11259022 missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11299968 missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11285876 missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11327757 missense probably benign 0.18
R5492:Adamts12 UTSW 15 11336298 missense probably benign 0.05
R5580:Adamts12 UTSW 15 11152000 missense probably benign 0.14
R5645:Adamts12 UTSW 15 11277420 missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11286750 missense probably benign 0.15
R6240:Adamts12 UTSW 15 11285958 missense probably benign 0.44
R6331:Adamts12 UTSW 15 11241433 missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11256994 missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11255635 missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11215673 missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11065101 missense probably benign 0.00
R6821:Adamts12 UTSW 15 11152048 missense probably benign 0.14
R6913:Adamts12 UTSW 15 11215692 missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11331780 nonsense probably null
R7188:Adamts12 UTSW 15 11336325 nonsense probably null
R7290:Adamts12 UTSW 15 11277366 missense probably benign 0.08
R7307:Adamts12 UTSW 15 11217813 missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11277339 missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11317279 missense probably benign 0.00
R7484:Adamts12 UTSW 15 11345648 missense probably benign 0.25
R7562:Adamts12 UTSW 15 11270611 missense probably benign 0.01
R7653:Adamts12 UTSW 15 11257029 missense probably benign 0.28
R7696:Adamts12 UTSW 15 11258138 missense probably damaging 1.00
V1662:Adamts12 UTSW 15 11071808 missense probably benign 0.13
X0022:Adamts12 UTSW 15 11277448 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ACAGTGTTCATGGGGTGGAAGC -3'
(R):5'- AGATGAAGGGCCAGATACTCACCAG -3'

Sequencing Primer
(F):5'- CATAGTGAGTCCAGTCCAAGTCG -3'
(R):5'- GATACTCACCAGTCCTTGGCAG -3'
Posted On2014-04-24