Incidental Mutation 'R1600:Tbx19'
ID176079
Institutional Source Beutler Lab
Gene Symbol Tbx19
Ensembl Gene ENSMUSG00000026572
Gene NameT-box 19
SynonymsTpit, D1Ertd754e
MMRRC Submission 039637-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.769) question?
Stock #R1600 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location165137855-165160773 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 165142567 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 251 (G251D)
Ref Sequence ENSEMBL: ENSMUSP00000027859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027859]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027859
AA Change: G251D

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027859
Gene: ENSMUSG00000026572
AA Change: G251D

DomainStartEndE-ValueType
TBOX 38 221 1.26e-114 SMART
low complexity region 263 275 N/A INTRINSIC
Blast:TBOX 343 410 2e-18 BLAST
low complexity region 424 443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160350
Predicted Effect probably benign
Transcript: ENSMUST00000161144
SMART Domains Protein: ENSMUSP00000123909
Gene: ENSMUSG00000026572

DomainStartEndE-ValueType
TBOX 1 156 4.56e-80 SMART
Blast:TBOX 215 282 5e-19 BLAST
low complexity region 296 315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161777
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 85% (41/48)
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcription factors containing a characteristic T-box DNA-binding domain. The encoded protein promotes expression of the pro-opiomelanocortin (POMC) gene, which is important for the differentiation of cells in the pituitary gland. [provided by RefSeq, Mar 2013]
PHENOTYPE: The phenotype of homozygous null mice is similar to that of patients with early onset pituitary ACTH deficiency. They are characterized by fasting-induced hypoglycemia due to an impaired pituitary-adrenal axis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,717 probably benign Het
Acot3 C T 12: 84,058,710 A317V probably benign Het
Ahrr T C 13: 74,214,378 D334G probably benign Het
Alpk2 C T 18: 65,378,037 V30M probably damaging Het
Arhgef25 G T 10: 127,185,289 H281N probably damaging Het
B3gntl1 A G 11: 121,630,836 M175T probably damaging Het
BC080695 A G 4: 143,571,967 E160G possibly damaging Het
Brca2 T A 5: 150,560,830 probably benign Het
Ccnj A T 19: 40,844,657 probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Col6a6 A G 9: 105,778,075 S816P probably damaging Het
Cul4a A G 8: 13,123,954 R64G probably damaging Het
Cul7 C A 17: 46,651,822 C126* probably null Het
Ercc2 T C 7: 19,385,941 Y176H probably benign Het
Frem2 T G 3: 53,547,723 D2144A probably damaging Het
Gabrg3 A T 7: 56,735,074 Y246* probably null Het
Gm21731 T C 13: 120,240,833 V55A probably benign Het
Gpatch2l T C 12: 86,256,934 probably null Het
Grk1 A G 8: 13,405,406 T97A probably benign Het
Hmcn2 A G 2: 31,430,787 E4004G probably damaging Het
Kcnu1 A T 8: 25,849,793 R46S probably damaging Het
Lrrfip1 T C 1: 91,114,667 S265P probably damaging Het
Lyve1 A G 7: 110,853,695 probably null Het
Mme A G 3: 63,365,058 Y659C probably damaging Het
Mrs2 G T 13: 24,995,410 N299K possibly damaging Het
Mtnr1b T C 9: 15,863,319 Y148C probably damaging Het
Myo5b T A 18: 74,713,540 probably benign Het
Neb A G 2: 52,271,604 Y2059H probably damaging Het
Nkain3 T C 4: 20,469,528 probably benign Het
Peg10 A T 6: 4,757,080 probably benign Het
Rufy2 A G 10: 63,006,671 T458A probably benign Het
Sec14l1 G A 11: 117,150,604 V448I probably benign Het
Trappc9 G A 15: 72,937,109 Q711* probably null Het
Trpm3 A G 19: 22,139,155 R13G probably benign Het
Usp33 G T 3: 152,379,610 A628S probably damaging Het
Vps13a T C 19: 16,666,272 N2080S probably benign Het
Wdr45b A T 11: 121,330,189 I221N probably damaging Het
Zfp119a A T 17: 55,868,355 W47R possibly damaging Het
Zswim9 A G 7: 13,269,571 C118R probably damaging Het
Other mutations in Tbx19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Tbx19 APN 1 165160399 missense probably benign 0.05
IGL00849:Tbx19 APN 1 165152040 missense probably benign 0.08
IGL01545:Tbx19 APN 1 165139156 missense possibly damaging 0.77
IGL01893:Tbx19 APN 1 165140198 missense possibly damaging 0.93
IGL02451:Tbx19 APN 1 165140171 missense probably benign 0.03
IGL02514:Tbx19 APN 1 165153704 missense probably benign 0.15
G1citation:Tbx19 UTSW 1 165140140 missense probably damaging 0.98
R0009:Tbx19 UTSW 1 165160520 missense possibly damaging 0.93
R0009:Tbx19 UTSW 1 165160520 missense possibly damaging 0.93
R4605:Tbx19 UTSW 1 165153584 missense possibly damaging 0.87
R5410:Tbx19 UTSW 1 165160372 missense probably damaging 0.99
R5441:Tbx19 UTSW 1 165153680 missense probably damaging 0.99
R6814:Tbx19 UTSW 1 165147633 critical splice donor site probably null
R6822:Tbx19 UTSW 1 165140140 missense probably damaging 0.98
R6872:Tbx19 UTSW 1 165147633 critical splice donor site probably null
R7078:Tbx19 UTSW 1 165160566 start gained probably benign
R7711:Tbx19 UTSW 1 165139199 missense probably benign
R8882:Tbx19 UTSW 1 165139211 missense probably benign 0.41
Z1176:Tbx19 UTSW 1 165142507 missense probably damaging 0.99
Z1177:Tbx19 UTSW 1 165142574 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGTCTCAGACCCCACAACTTGAC -3'
(R):5'- CCTGCCAGAAGGTATCATTTTCCCC -3'

Sequencing Primer
(F):5'- GTACACTGACCCTGAGTCAAGG -3'
(R):5'- TTTTCCCCCTGGGTAGAAAAGAG -3'
Posted On2014-04-24