Incidental Mutation 'R1600:Nkain3'
ID176085
Institutional Source Beutler Lab
Gene Symbol Nkain3
Ensembl Gene ENSMUSG00000055761
Gene NameNa+/K+ transporting ATPase interacting 3
Synonyms
MMRRC Submission 039637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1600 (G1)
Quality Score218
Status Validated
Chromosome4
Chromosomal Location20118874-20778866 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 20469528 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102998] [ENSMUST00000119374]
Predicted Effect probably benign
Transcript: ENSMUST00000102998
SMART Domains Protein: ENSMUSP00000100063
Gene: ENSMUSG00000055761

DomainStartEndE-ValueType
Pfam:NKAIN 1 162 1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119374
SMART Domains Protein: ENSMUSP00000113113
Gene: ENSMUSG00000055761

DomainStartEndE-ValueType
Pfam:NKAIN 1 180 7e-83 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 85% (41/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NKAIN3 is a member of a family of mammalian proteins (see NKAIN1; MIM 612871) with similarity to Drosophila Nkain (Gorokhova et al., 2007 [PubMed 17606467]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,717 probably benign Het
Acot3 C T 12: 84,058,710 A317V probably benign Het
Ahrr T C 13: 74,214,378 D334G probably benign Het
Alpk2 C T 18: 65,378,037 V30M probably damaging Het
Arhgef25 G T 10: 127,185,289 H281N probably damaging Het
B3gntl1 A G 11: 121,630,836 M175T probably damaging Het
BC080695 A G 4: 143,571,967 E160G possibly damaging Het
Brca2 T A 5: 150,560,830 probably benign Het
Ccnj A T 19: 40,844,657 probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Col6a6 A G 9: 105,778,075 S816P probably damaging Het
Cul4a A G 8: 13,123,954 R64G probably damaging Het
Cul7 C A 17: 46,651,822 C126* probably null Het
Ercc2 T C 7: 19,385,941 Y176H probably benign Het
Frem2 T G 3: 53,547,723 D2144A probably damaging Het
Gabrg3 A T 7: 56,735,074 Y246* probably null Het
Gm21731 T C 13: 120,240,833 V55A probably benign Het
Gpatch2l T C 12: 86,256,934 probably null Het
Grk1 A G 8: 13,405,406 T97A probably benign Het
Hmcn2 A G 2: 31,430,787 E4004G probably damaging Het
Kcnu1 A T 8: 25,849,793 R46S probably damaging Het
Lrrfip1 T C 1: 91,114,667 S265P probably damaging Het
Lyve1 A G 7: 110,853,695 probably null Het
Mme A G 3: 63,365,058 Y659C probably damaging Het
Mrs2 G T 13: 24,995,410 N299K possibly damaging Het
Mtnr1b T C 9: 15,863,319 Y148C probably damaging Het
Myo5b T A 18: 74,713,540 probably benign Het
Neb A G 2: 52,271,604 Y2059H probably damaging Het
Peg10 A T 6: 4,757,080 probably benign Het
Rufy2 A G 10: 63,006,671 T458A probably benign Het
Sec14l1 G A 11: 117,150,604 V448I probably benign Het
Tbx19 C T 1: 165,142,567 G251D possibly damaging Het
Trappc9 G A 15: 72,937,109 Q711* probably null Het
Trpm3 A G 19: 22,139,155 R13G probably benign Het
Usp33 G T 3: 152,379,610 A628S probably damaging Het
Vps13a T C 19: 16,666,272 N2080S probably benign Het
Wdr45b A T 11: 121,330,189 I221N probably damaging Het
Zfp119a A T 17: 55,868,355 W47R possibly damaging Het
Zswim9 A G 7: 13,269,571 C118R probably damaging Het
Other mutations in Nkain3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02610:Nkain3 APN 4 20469459 missense probably damaging 1.00
I1329:Nkain3 UTSW 4 20158329 splice site probably benign
IGL03055:Nkain3 UTSW 4 20778308 missense probably benign 0.01
R0726:Nkain3 UTSW 4 20158388 missense possibly damaging 0.67
R1485:Nkain3 UTSW 4 20484932 missense probably damaging 1.00
R1702:Nkain3 UTSW 4 20158339 critical splice donor site probably null
R3707:Nkain3 UTSW 4 20484920 missense possibly damaging 0.65
R4192:Nkain3 UTSW 4 20485003 nonsense probably null
R4392:Nkain3 UTSW 4 20282985 missense possibly damaging 0.89
R4410:Nkain3 UTSW 4 20778284 missense probably benign 0.20
R4721:Nkain3 UTSW 4 20485015 missense probably damaging 0.98
R5333:Nkain3 UTSW 4 20484889 missense probably benign 0.04
R5978:Nkain3 UTSW 4 20485026 splice site probably null
R7208:Nkain3 UTSW 4 20282892 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCGTGATTTTGAAAGCCCTTTACA -3'
(R):5'- AGGTTTCCAGGTGTTCATTAACAACTGT -3'

Sequencing Primer
(F):5'- actctcctatctcaacctccc -3'
(R):5'- TAGGGACCAGGGCTTTACAATTTC -3'
Posted On2014-04-24