Incidental Mutation 'R1600:BC080695'
ID176086
Institutional Source Beutler Lab
Gene Symbol BC080695
Ensembl Gene ENSMUSG00000070618
Gene NamecDNA sequence BC080695
Synonyms
MMRRC Submission 039637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1600 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143551700-143573798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143571967 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 160 (E160G)
Ref Sequence ENSEMBL: ENSMUSP00000101400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105765] [ENSMUST00000105774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105765
AA Change: E160G

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101391
Gene: ENSMUSG00000070618
AA Change: E160G

DomainStartEndE-ValueType
SCOP:d1a4ya_ 210 414 5e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105774
AA Change: E160G

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101400
Gene: ENSMUSG00000070618
AA Change: E160G

DomainStartEndE-ValueType
SCOP:d1a4ya_ 210 414 5e-12 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 85% (41/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,717 probably benign Het
Acot3 C T 12: 84,058,710 A317V probably benign Het
Ahrr T C 13: 74,214,378 D334G probably benign Het
Alpk2 C T 18: 65,378,037 V30M probably damaging Het
Arhgef25 G T 10: 127,185,289 H281N probably damaging Het
B3gntl1 A G 11: 121,630,836 M175T probably damaging Het
Brca2 T A 5: 150,560,830 probably benign Het
Ccnj A T 19: 40,844,657 probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Col6a6 A G 9: 105,778,075 S816P probably damaging Het
Cul4a A G 8: 13,123,954 R64G probably damaging Het
Cul7 C A 17: 46,651,822 C126* probably null Het
Ercc2 T C 7: 19,385,941 Y176H probably benign Het
Frem2 T G 3: 53,547,723 D2144A probably damaging Het
Gabrg3 A T 7: 56,735,074 Y246* probably null Het
Gm21731 T C 13: 120,240,833 V55A probably benign Het
Gpatch2l T C 12: 86,256,934 probably null Het
Grk1 A G 8: 13,405,406 T97A probably benign Het
Hmcn2 A G 2: 31,430,787 E4004G probably damaging Het
Kcnu1 A T 8: 25,849,793 R46S probably damaging Het
Lrrfip1 T C 1: 91,114,667 S265P probably damaging Het
Lyve1 A G 7: 110,853,695 probably null Het
Mme A G 3: 63,365,058 Y659C probably damaging Het
Mrs2 G T 13: 24,995,410 N299K possibly damaging Het
Mtnr1b T C 9: 15,863,319 Y148C probably damaging Het
Myo5b T A 18: 74,713,540 probably benign Het
Neb A G 2: 52,271,604 Y2059H probably damaging Het
Nkain3 T C 4: 20,469,528 probably benign Het
Peg10 A T 6: 4,757,080 probably benign Het
Rufy2 A G 10: 63,006,671 T458A probably benign Het
Sec14l1 G A 11: 117,150,604 V448I probably benign Het
Tbx19 C T 1: 165,142,567 G251D possibly damaging Het
Trappc9 G A 15: 72,937,109 Q711* probably null Het
Trpm3 A G 19: 22,139,155 R13G probably benign Het
Usp33 G T 3: 152,379,610 A628S probably damaging Het
Vps13a T C 19: 16,666,272 N2080S probably benign Het
Wdr45b A T 11: 121,330,189 I221N probably damaging Het
Zfp119a A T 17: 55,868,355 W47R possibly damaging Het
Zswim9 A G 7: 13,269,571 C118R probably damaging Het
Other mutations in BC080695
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:BC080695 APN 4 143571156 missense probably benign 0.42
IGL02533:BC080695 APN 4 143571002 utr 5 prime probably benign
R0352:BC080695 UTSW 4 143571308 splice site probably benign
R3121:BC080695 UTSW 4 143571013 start codon destroyed probably null 1.00
R4005:BC080695 UTSW 4 143572269 missense probably benign 0.00
R4477:BC080695 UTSW 4 143571162 missense probably benign 0.21
R4639:BC080695 UTSW 4 143571897 missense probably benign 0.22
R4791:BC080695 UTSW 4 143570989 start gained probably benign
R5118:BC080695 UTSW 4 143571127 missense probably damaging 1.00
R5353:BC080695 UTSW 4 143571237 missense probably benign 0.00
R5861:BC080695 UTSW 4 143571240 missense probably benign
R6163:BC080695 UTSW 4 143572035 missense probably damaging 1.00
R6286:BC080695 UTSW 4 143571226 missense probably benign
R6958:BC080695 UTSW 4 143571259 missense probably damaging 1.00
R7391:BC080695 UTSW 4 143572306 missense probably damaging 1.00
R7625:BC080695 UTSW 4 143572251 missense probably benign 0.00
Z1176:BC080695 UTSW 4 143572252 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAGTGCTGGACCTGAGAAATGTG -3'
(R):5'- CCGGAGACTGTTGAGTTTGGAGAAC -3'

Sequencing Primer
(F):5'- CAGCAGAGACAGTGTGTCAA -3'
(R):5'- TTCTTCATCTGACCAAGGCAAGG -3'
Posted On2014-04-24