Incidental Mutation 'R1600:Ercc2'
ID176090
Institutional Source Beutler Lab
Gene Symbol Ercc2
Ensembl Gene ENSMUSG00000030400
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 2
SynonymsXPD, Ercc-2
MMRRC Submission 039637-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1600 (G1)
Quality Score175
Status Validated
Chromosome7
Chromosomal Location19382010-19395694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19385941 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 176 (Y176H)
Ref Sequence ENSEMBL: ENSMUSP00000104100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062831] [ENSMUST00000108460] [ENSMUST00000108461]
Predicted Effect probably benign
Transcript: ENSMUST00000062831
AA Change: Y197H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054380
Gene: ENSMUSG00000030400
AA Change: Y197H

DomainStartEndE-ValueType
DEXDc 8 280 1.62e-144 SMART
Blast:DEXDc2 340 369 3e-10 BLAST
Blast:DEXDc 412 467 9e-27 BLAST
HELICc 542 686 1.32e-76 SMART
low complexity region 733 751 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102360
Predicted Effect probably benign
Transcript: ENSMUST00000108460
AA Change: Y176H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104100
Gene: ENSMUSG00000030400
AA Change: Y176H

DomainStartEndE-ValueType
DEXDc 8 259 1.7e-120 SMART
Blast:DEXDc2 319 348 3e-10 BLAST
Blast:DEXDc 391 446 8e-27 BLAST
HELICc 521 665 1.32e-76 SMART
low complexity region 712 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108461
SMART Domains Protein: ENSMUSP00000104101
Gene: ENSMUSG00000030400

DomainStartEndE-ValueType
Pfam:DUF1227 16 161 4.5e-60 PFAM
Blast:HELICc2 193 262 1e-40 BLAST
HELICc 290 434 1.32e-76 SMART
low complexity region 481 499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128167
Predicted Effect probably benign
Transcript: ENSMUST00000129249
SMART Domains Protein: ENSMUSP00000117840
Gene: ENSMUSG00000030400

DomainStartEndE-ValueType
DEXDc 10 204 1.14e-71 SMART
Blast:DEXDc2 264 293 2e-10 BLAST
Blast:DEXDc 336 391 5e-27 BLAST
HELICc 466 610 1.32e-76 SMART
low complexity region 657 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180691
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 85% (41/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nucleotide excision repair pathway is a mechanism to repair damage to DNA. The protein encoded by this gene is involved in transcription-coupled nucleotide excision repair and is an integral member of the basal transcription factor BTF2/TFIIH complex. The gene product has ATP-dependent DNA helicase activity and belongs to the RAD3/XPD subfamily of helicases. Defects in this gene can result in three different disorders, the cancer-prone syndrome xeroderma pigmentosum complementation group D, trichothiodystrophy, and Cockayne syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die prior to implantation. Homozygotes for a targeted missense mutation exhibit brittle and greying hair, cachexia, infertility, osteosclerosis, osteoporosis, reduced lifespan, UV sensitivity, and skin defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,717 probably benign Het
Acot3 C T 12: 84,058,710 A317V probably benign Het
Ahrr T C 13: 74,214,378 D334G probably benign Het
Alpk2 C T 18: 65,378,037 V30M probably damaging Het
Arhgef25 G T 10: 127,185,289 H281N probably damaging Het
B3gntl1 A G 11: 121,630,836 M175T probably damaging Het
BC080695 A G 4: 143,571,967 E160G possibly damaging Het
Brca2 T A 5: 150,560,830 probably benign Het
Ccnj A T 19: 40,844,657 probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Col6a6 A G 9: 105,778,075 S816P probably damaging Het
Cul4a A G 8: 13,123,954 R64G probably damaging Het
Cul7 C A 17: 46,651,822 C126* probably null Het
Frem2 T G 3: 53,547,723 D2144A probably damaging Het
Gabrg3 A T 7: 56,735,074 Y246* probably null Het
Gm21731 T C 13: 120,240,833 V55A probably benign Het
Gpatch2l T C 12: 86,256,934 probably null Het
Grk1 A G 8: 13,405,406 T97A probably benign Het
Hmcn2 A G 2: 31,430,787 E4004G probably damaging Het
Kcnu1 A T 8: 25,849,793 R46S probably damaging Het
Lrrfip1 T C 1: 91,114,667 S265P probably damaging Het
Lyve1 A G 7: 110,853,695 probably null Het
Mme A G 3: 63,365,058 Y659C probably damaging Het
Mrs2 G T 13: 24,995,410 N299K possibly damaging Het
Mtnr1b T C 9: 15,863,319 Y148C probably damaging Het
Myo5b T A 18: 74,713,540 probably benign Het
Neb A G 2: 52,271,604 Y2059H probably damaging Het
Nkain3 T C 4: 20,469,528 probably benign Het
Peg10 A T 6: 4,757,080 probably benign Het
Rufy2 A G 10: 63,006,671 T458A probably benign Het
Sec14l1 G A 11: 117,150,604 V448I probably benign Het
Tbx19 C T 1: 165,142,567 G251D possibly damaging Het
Trappc9 G A 15: 72,937,109 Q711* probably null Het
Trpm3 A G 19: 22,139,155 R13G probably benign Het
Usp33 G T 3: 152,379,610 A628S probably damaging Het
Vps13a T C 19: 16,666,272 N2080S probably benign Het
Wdr45b A T 11: 121,330,189 I221N probably damaging Het
Zfp119a A T 17: 55,868,355 W47R possibly damaging Het
Zswim9 A G 7: 13,269,571 C118R probably damaging Het
Other mutations in Ercc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Ercc2 APN 7 19390417 missense probably benign 0.03
IGL01767:Ercc2 APN 7 19390421 missense probably damaging 1.00
IGL01810:Ercc2 APN 7 19393449 missense probably damaging 1.00
IGL02485:Ercc2 APN 7 19394045 missense possibly damaging 0.83
IGL02891:Ercc2 APN 7 19393286 missense probably damaging 1.00
IGL03010:Ercc2 APN 7 19391566 missense possibly damaging 0.89
R0304:Ercc2 UTSW 7 19386708 missense possibly damaging 0.75
R0512:Ercc2 UTSW 7 19393887 missense probably damaging 0.99
R1467:Ercc2 UTSW 7 19385886 missense probably benign 0.05
R1467:Ercc2 UTSW 7 19385886 missense probably benign 0.05
R1636:Ercc2 UTSW 7 19387124 missense possibly damaging 0.94
R2156:Ercc2 UTSW 7 19386792 missense possibly damaging 0.95
R2446:Ercc2 UTSW 7 19386944 missense probably damaging 0.97
R4458:Ercc2 UTSW 7 19393846 missense probably damaging 1.00
R4869:Ercc2 UTSW 7 19386807 missense probably damaging 1.00
R5861:Ercc2 UTSW 7 19394141 missense possibly damaging 0.91
R6960:Ercc2 UTSW 7 19393690 missense probably damaging 0.98
R7301:Ercc2 UTSW 7 19394135 missense probably benign 0.09
R7354:Ercc2 UTSW 7 19393654 missense possibly damaging 0.91
R8485:Ercc2 UTSW 7 19388240 missense possibly damaging 0.89
Z1176:Ercc2 UTSW 7 19385668 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTATGAGGTACAGGGAAGAGCCTAGAA -3'
(R):5'- ACGGAGACAGACGATCCAGACAA -3'

Sequencing Primer
(F):5'- GAGCCTAGAACTGGTGAGC -3'
(R):5'- ATAAAGACGTAACAGCACAGAGTC -3'
Posted On2014-04-24