Incidental Mutation 'R1600:Gabrg3'
ID176091
Institutional Source Beutler Lab
Gene Symbol Gabrg3
Ensembl Gene ENSMUSG00000055026
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit gamma 3
SynonymsGabrg-3, B230362M20Rik
MMRRC Submission 039637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1600 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location56716465-57387188 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 56735074 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 246 (Y246*)
Ref Sequence ENSEMBL: ENSMUSP00000067632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068911]
Predicted Effect probably null
Transcript: ENSMUST00000068911
AA Change: Y246*
SMART Domains Protein: ENSMUSP00000067632
Gene: ENSMUSG00000055026
AA Change: Y246*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Neur_chan_LBD 47 253 2.9e-51 PFAM
Pfam:Neur_chan_memb 260 461 1.4e-39 PFAM
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 85% (41/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. The protein encoded by this gene is a gamma subunit, which contains the benzodiazepine binding site. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,717 probably benign Het
Acot3 C T 12: 84,058,710 A317V probably benign Het
Ahrr T C 13: 74,214,378 D334G probably benign Het
Alpk2 C T 18: 65,378,037 V30M probably damaging Het
Arhgef25 G T 10: 127,185,289 H281N probably damaging Het
B3gntl1 A G 11: 121,630,836 M175T probably damaging Het
BC080695 A G 4: 143,571,967 E160G possibly damaging Het
Brca2 T A 5: 150,560,830 probably benign Het
Ccnj A T 19: 40,844,657 probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Col6a6 A G 9: 105,778,075 S816P probably damaging Het
Cul4a A G 8: 13,123,954 R64G probably damaging Het
Cul7 C A 17: 46,651,822 C126* probably null Het
Ercc2 T C 7: 19,385,941 Y176H probably benign Het
Frem2 T G 3: 53,547,723 D2144A probably damaging Het
Gm21731 T C 13: 120,240,833 V55A probably benign Het
Gpatch2l T C 12: 86,256,934 probably null Het
Grk1 A G 8: 13,405,406 T97A probably benign Het
Hmcn2 A G 2: 31,430,787 E4004G probably damaging Het
Kcnu1 A T 8: 25,849,793 R46S probably damaging Het
Lrrfip1 T C 1: 91,114,667 S265P probably damaging Het
Lyve1 A G 7: 110,853,695 probably null Het
Mme A G 3: 63,365,058 Y659C probably damaging Het
Mrs2 G T 13: 24,995,410 N299K possibly damaging Het
Mtnr1b T C 9: 15,863,319 Y148C probably damaging Het
Myo5b T A 18: 74,713,540 probably benign Het
Neb A G 2: 52,271,604 Y2059H probably damaging Het
Nkain3 T C 4: 20,469,528 probably benign Het
Peg10 A T 6: 4,757,080 probably benign Het
Rufy2 A G 10: 63,006,671 T458A probably benign Het
Sec14l1 G A 11: 117,150,604 V448I probably benign Het
Tbx19 C T 1: 165,142,567 G251D possibly damaging Het
Trappc9 G A 15: 72,937,109 Q711* probably null Het
Trpm3 A G 19: 22,139,155 R13G probably benign Het
Usp33 G T 3: 152,379,610 A628S probably damaging Het
Vps13a T C 19: 16,666,272 N2080S probably benign Het
Wdr45b A T 11: 121,330,189 I221N probably damaging Het
Zfp119a A T 17: 55,868,355 W47R possibly damaging Het
Zswim9 A G 7: 13,269,571 C118R probably damaging Het
Other mutations in Gabrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Gabrg3 APN 7 57381667 missense probably damaging 0.99
IGL01501:Gabrg3 APN 7 56724466 missense probably damaging 0.99
IGL02637:Gabrg3 APN 7 56735027 missense probably damaging 0.99
IGL02707:Gabrg3 APN 7 56982691 nonsense probably null
IGL03084:Gabrg3 APN 7 56735064 missense possibly damaging 0.91
IGL03237:Gabrg3 APN 7 56982712 splice site probably null
IGL03275:Gabrg3 APN 7 56773347 missense probably damaging 1.00
IGL03309:Gabrg3 APN 7 56982685 missense probably damaging 1.00
R0265:Gabrg3 UTSW 7 57381617 nonsense probably null
R0612:Gabrg3 UTSW 7 56729706 missense probably damaging 0.99
R0627:Gabrg3 UTSW 7 56724595 missense probably damaging 0.99
R0676:Gabrg3 UTSW 7 56724421 missense probably damaging 0.99
R1178:Gabrg3 UTSW 7 56735091 missense probably benign 0.01
R1702:Gabrg3 UTSW 7 56985100 missense probably damaging 0.98
R1836:Gabrg3 UTSW 7 56729641 missense probably damaging 1.00
R2327:Gabrg3 UTSW 7 56735087 missense probably benign 0.01
R3816:Gabrg3 UTSW 7 57381664 nonsense probably null
R3818:Gabrg3 UTSW 7 57381664 nonsense probably null
R3819:Gabrg3 UTSW 7 57381664 nonsense probably null
R4905:Gabrg3 UTSW 7 56724556 missense probably damaging 0.98
R5643:Gabrg3 UTSW 7 56773284 missense possibly damaging 0.95
R6088:Gabrg3 UTSW 7 56985078 missense probably damaging 1.00
R6862:Gabrg3 UTSW 7 56773311 missense possibly damaging 0.54
R6879:Gabrg3 UTSW 7 57381639 missense probably damaging 1.00
R7075:Gabrg3 UTSW 7 57323696 missense probably damaging 0.99
R7305:Gabrg3 UTSW 7 56735085 missense probably benign 0.01
R7594:Gabrg3 UTSW 7 56982695 missense possibly damaging 0.90
R7793:Gabrg3 UTSW 7 57179580 missense probably benign 0.00
R7886:Gabrg3 UTSW 7 56724481 missense probably damaging 1.00
R7989:Gabrg3 UTSW 7 56724641 missense possibly damaging 0.70
R8002:Gabrg3 UTSW 7 56734968 missense possibly damaging 0.90
R8203:Gabrg3 UTSW 7 56773260 missense possibly damaging 0.65
R8875:Gabrg3 UTSW 7 56729766 missense probably damaging 1.00
R8933:Gabrg3 UTSW 7 56984958 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCTTGGAAGAAAGCTGCCTATGC -3'
(R):5'- CCTTGTCAAATTGCCTGCCATTGTG -3'

Sequencing Primer
(F):5'- AGCCTGGTTCACATAGTTCTTAGAC -3'
(R):5'- GCACAGGCATGGTACAGTTC -3'
Posted On2014-04-24