Incidental Mutation 'R1600:Cul4a'
ID176094
Institutional Source Beutler Lab
Gene Symbol Cul4a
Ensembl Gene ENSMUSG00000031446
Gene Namecullin 4A
Synonyms2810470J21Rik
MMRRC Submission 039637-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.616) question?
Stock #R1600 (G1)
Quality Score224
Status Validated
Chromosome8
Chromosomal Location13105621-13147940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13123954 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 64 (R64G)
Ref Sequence ENSEMBL: ENSMUSP00000123074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016680] [ENSMUST00000121426] [ENSMUST00000125514]
Predicted Effect probably benign
Transcript: ENSMUST00000016680
AA Change: R254G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000016680
Gene: ENSMUSG00000031446
AA Change: R254G

DomainStartEndE-ValueType
low complexity region 20 39 N/A INTRINSIC
SCOP:d1ldja2 61 401 1e-118 SMART
Blast:CULLIN 83 151 5e-9 BLAST
CULLIN 434 582 1.6e-76 SMART
Blast:CULLIN 585 640 7e-28 BLAST
Cullin_Nedd8 688 753 8.29e-35 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121426
AA Change: R254G

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112525
Gene: ENSMUSG00000031446
AA Change: R254G

DomainStartEndE-ValueType
low complexity region 20 39 N/A INTRINSIC
Pfam:Cullin 63 259 3.1e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125514
AA Change: R64G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123074
Gene: ENSMUSG00000031446
AA Change: R64G

DomainStartEndE-ValueType
Pfam:Cullin 1 68 5.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141315
Meta Mutation Damage Score 0.1996 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 85% (41/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CUL4A is the ubiquitin ligase component of a multimeric complex involved in the degradation of DNA damage-response proteins (Liu et al., 2009 [PubMed 19481525]).[supplied by OMIM, Oct 2009]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit reduced female fertility, male infertility, impaired spermatogenesis, and impaired DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,717 probably benign Het
Acot3 C T 12: 84,058,710 A317V probably benign Het
Ahrr T C 13: 74,214,378 D334G probably benign Het
Alpk2 C T 18: 65,378,037 V30M probably damaging Het
Arhgef25 G T 10: 127,185,289 H281N probably damaging Het
B3gntl1 A G 11: 121,630,836 M175T probably damaging Het
BC080695 A G 4: 143,571,967 E160G possibly damaging Het
Brca2 T A 5: 150,560,830 probably benign Het
Ccnj A T 19: 40,844,657 probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Col6a6 A G 9: 105,778,075 S816P probably damaging Het
Cul7 C A 17: 46,651,822 C126* probably null Het
Ercc2 T C 7: 19,385,941 Y176H probably benign Het
Frem2 T G 3: 53,547,723 D2144A probably damaging Het
Gabrg3 A T 7: 56,735,074 Y246* probably null Het
Gm21731 T C 13: 120,240,833 V55A probably benign Het
Gpatch2l T C 12: 86,256,934 probably null Het
Grk1 A G 8: 13,405,406 T97A probably benign Het
Hmcn2 A G 2: 31,430,787 E4004G probably damaging Het
Kcnu1 A T 8: 25,849,793 R46S probably damaging Het
Lrrfip1 T C 1: 91,114,667 S265P probably damaging Het
Lyve1 A G 7: 110,853,695 probably null Het
Mme A G 3: 63,365,058 Y659C probably damaging Het
Mrs2 G T 13: 24,995,410 N299K possibly damaging Het
Mtnr1b T C 9: 15,863,319 Y148C probably damaging Het
Myo5b T A 18: 74,713,540 probably benign Het
Neb A G 2: 52,271,604 Y2059H probably damaging Het
Nkain3 T C 4: 20,469,528 probably benign Het
Peg10 A T 6: 4,757,080 probably benign Het
Rufy2 A G 10: 63,006,671 T458A probably benign Het
Sec14l1 G A 11: 117,150,604 V448I probably benign Het
Tbx19 C T 1: 165,142,567 G251D possibly damaging Het
Trappc9 G A 15: 72,937,109 Q711* probably null Het
Trpm3 A G 19: 22,139,155 R13G probably benign Het
Usp33 G T 3: 152,379,610 A628S probably damaging Het
Vps13a T C 19: 16,666,272 N2080S probably benign Het
Wdr45b A T 11: 121,330,189 I221N probably damaging Het
Zfp119a A T 17: 55,868,355 W47R possibly damaging Het
Zswim9 A G 7: 13,269,571 C118R probably damaging Het
Other mutations in Cul4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Cul4a APN 8 13127735 missense probably benign 0.18
IGL00952:Cul4a APN 8 13146562 missense probably damaging 1.00
IGL01604:Cul4a APN 8 13133843 critical splice donor site probably null
IGL01688:Cul4a APN 8 13146571 nonsense probably null
IGL02167:Cul4a APN 8 13122826 missense probably damaging 1.00
IGL02927:Cul4a APN 8 13124861 missense possibly damaging 0.55
IGL03066:Cul4a APN 8 13133776 missense probably benign 0.22
R0183:Cul4a UTSW 8 13133790 missense probably damaging 0.98
R1860:Cul4a UTSW 8 13123565 missense probably damaging 1.00
R1865:Cul4a UTSW 8 13142589 missense possibly damaging 0.94
R1905:Cul4a UTSW 8 13133171 missense probably benign 0.06
R1964:Cul4a UTSW 8 13136406 missense possibly damaging 0.62
R1964:Cul4a UTSW 8 13136854 missense probably benign 0.00
R2381:Cul4a UTSW 8 13136887 missense probably benign 0.45
R3787:Cul4a UTSW 8 13133668 missense probably damaging 0.99
R4006:Cul4a UTSW 8 13122859 missense probably benign 0.04
R4007:Cul4a UTSW 8 13122859 missense probably benign 0.04
R4748:Cul4a UTSW 8 13123526 missense probably benign 0.06
R5244:Cul4a UTSW 8 13146566 missense probably damaging 1.00
R6389:Cul4a UTSW 8 13140278 missense probably benign
R6736:Cul4a UTSW 8 13136219 missense probably benign 0.00
R7201:Cul4a UTSW 8 13142991 missense probably damaging 0.98
R7313:Cul4a UTSW 8 13121676 critical splice acceptor site probably benign
R7446:Cul4a UTSW 8 13136874 missense probably benign
R7485:Cul4a UTSW 8 13140279 missense possibly damaging 0.68
R7569:Cul4a UTSW 8 13123493 missense probably benign
R8219:Cul4a UTSW 8 13146540 missense possibly damaging 0.91
R8304:Cul4a UTSW 8 13127727 missense possibly damaging 0.88
X0026:Cul4a UTSW 8 13105871 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CGCCAAAGTAAAGGCAGGCTTCAG -3'
(R):5'- TGGCTCCACATAGGACTCATCACTC -3'

Sequencing Primer
(F):5'- CCAGAAGTATGAGTGGACATCCC -3'
(R):5'- CTTGCTTAGACATAGGCTCAGAC -3'
Posted On2014-04-24