Incidental Mutation 'R1600:Mtnr1b'
ID176097
Institutional Source Beutler Lab
Gene Symbol Mtnr1b
Ensembl Gene ENSMUSG00000050901
Gene Namemelatonin receptor 1B
SynonymsMt2, Mel1b
MMRRC Submission 039637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1600 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location15824528-15874556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15863319 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 148 (Y148C)
Ref Sequence ENSEMBL: ENSMUSP00000138524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057920] [ENSMUST00000182947]
Predicted Effect probably damaging
Transcript: ENSMUST00000057920
AA Change: Y148C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053086
Gene: ENSMUSG00000050901
AA Change: Y148C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 254 3.7e-11 PFAM
Pfam:7TM_GPCR_Srsx 51 323 2.6e-12 PFAM
Pfam:7tm_1 57 308 3.4e-47 PFAM
Pfam:7TM_GPCR_Srv 59 317 1.1e-7 PFAM
low complexity region 348 359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182947
AA Change: Y148C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138524
Gene: ENSMUSG00000050901
AA Change: Y148C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 264 1.8e-10 PFAM
Pfam:7TM_GPCR_Srsx 51 323 2.6e-12 PFAM
Pfam:7tm_1 57 308 1.4e-50 PFAM
Pfam:7TM_GPCR_Srv 59 319 7.5e-8 PFAM
low complexity region 348 359 N/A INTRINSIC
Meta Mutation Damage Score 0.6929 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 85% (41/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This gene product is an integral membrane protein that is a G-protein coupled, 7-transmembrane receptor. It is found primarily in the retina and brain although this detection requires RT-PCR. It is thought to participate in light-dependent functions in the retina and may be involved in the neurobiological effects of melatonin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and display no obvious circadian phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,717 probably benign Het
Acot3 C T 12: 84,058,710 A317V probably benign Het
Ahrr T C 13: 74,214,378 D334G probably benign Het
Alpk2 C T 18: 65,378,037 V30M probably damaging Het
Arhgef25 G T 10: 127,185,289 H281N probably damaging Het
B3gntl1 A G 11: 121,630,836 M175T probably damaging Het
BC080695 A G 4: 143,571,967 E160G possibly damaging Het
Brca2 T A 5: 150,560,830 probably benign Het
Ccnj A T 19: 40,844,657 probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Col6a6 A G 9: 105,778,075 S816P probably damaging Het
Cul4a A G 8: 13,123,954 R64G probably damaging Het
Cul7 C A 17: 46,651,822 C126* probably null Het
Ercc2 T C 7: 19,385,941 Y176H probably benign Het
Frem2 T G 3: 53,547,723 D2144A probably damaging Het
Gabrg3 A T 7: 56,735,074 Y246* probably null Het
Gm21731 T C 13: 120,240,833 V55A probably benign Het
Gpatch2l T C 12: 86,256,934 probably null Het
Grk1 A G 8: 13,405,406 T97A probably benign Het
Hmcn2 A G 2: 31,430,787 E4004G probably damaging Het
Kcnu1 A T 8: 25,849,793 R46S probably damaging Het
Lrrfip1 T C 1: 91,114,667 S265P probably damaging Het
Lyve1 A G 7: 110,853,695 probably null Het
Mme A G 3: 63,365,058 Y659C probably damaging Het
Mrs2 G T 13: 24,995,410 N299K possibly damaging Het
Myo5b T A 18: 74,713,540 probably benign Het
Neb A G 2: 52,271,604 Y2059H probably damaging Het
Nkain3 T C 4: 20,469,528 probably benign Het
Peg10 A T 6: 4,757,080 probably benign Het
Rufy2 A G 10: 63,006,671 T458A probably benign Het
Sec14l1 G A 11: 117,150,604 V448I probably benign Het
Tbx19 C T 1: 165,142,567 G251D possibly damaging Het
Trappc9 G A 15: 72,937,109 Q711* probably null Het
Trpm3 A G 19: 22,139,155 R13G probably benign Het
Usp33 G T 3: 152,379,610 A628S probably damaging Het
Vps13a T C 19: 16,666,272 N2080S probably benign Het
Wdr45b A T 11: 121,330,189 I221N probably damaging Het
Zfp119a A T 17: 55,868,355 W47R possibly damaging Het
Zswim9 A G 7: 13,269,571 C118R probably damaging Het
Other mutations in Mtnr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Mtnr1b APN 9 15863200 missense probably damaging 1.00
IGL02041:Mtnr1b APN 9 15863293 missense probably benign 0.01
IGL02054:Mtnr1b APN 9 15874240 missense possibly damaging 0.93
IGL02147:Mtnr1b APN 9 15863376 missense probably damaging 0.96
IGL02620:Mtnr1b APN 9 15874321 missense possibly damaging 0.47
IGL03046:Mtnr1b UTSW 9 15862763 missense probably benign 0.00
R0362:Mtnr1b UTSW 9 15874304 missense probably damaging 1.00
R0784:Mtnr1b UTSW 9 15862785 missense probably benign 0.17
R1323:Mtnr1b UTSW 9 15863136 missense probably damaging 1.00
R1323:Mtnr1b UTSW 9 15863136 missense probably damaging 1.00
R1572:Mtnr1b UTSW 9 15863142 missense probably damaging 0.99
R2880:Mtnr1b UTSW 9 15862806 missense probably damaging 1.00
R2932:Mtnr1b UTSW 9 15874324 missense probably damaging 0.97
R4033:Mtnr1b UTSW 9 15863534 missense probably damaging 1.00
R5532:Mtnr1b UTSW 9 15862914 missense probably benign
R5765:Mtnr1b UTSW 9 15863163 missense probably damaging 1.00
R5775:Mtnr1b UTSW 9 15862872 missense possibly damaging 0.73
R5893:Mtnr1b UTSW 9 15863244 missense probably damaging 0.98
R6025:Mtnr1b UTSW 9 15862797 missense probably damaging 1.00
R6247:Mtnr1b UTSW 9 15862786 missense probably benign
R6349:Mtnr1b UTSW 9 15863213 nonsense probably null
R6364:Mtnr1b UTSW 9 15863004 missense possibly damaging 0.63
R7485:Mtnr1b UTSW 9 15863294 nonsense probably null
R8114:Mtnr1b UTSW 9 15874267 missense probably damaging 0.98
R8707:Mtnr1b UTSW 9 15874513 start gained probably benign
R8750:Mtnr1b UTSW 9 15874428 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCAGATTCGCAGGTAGCAGAAG -3'
(R):5'- TGGTGATAGCCTTGTACCCTTACCC -3'

Sequencing Primer
(F):5'- CAGGTAGCAGAAGGACACCAC -3'
(R):5'- ACCCACTGATCCTTGTGGC -3'
Posted On2014-04-24