Mutagenetix > Incidental Mutation

Incidental Mutation 'R1600:Col6a6'

176098

Institutional Source

Beutler Lab

Gene Symbol

Col6a6

Ensembl Gene

ENSMUSG00000043719

Gene Name

collagen, type VI, alpha 6

Synonyms

E330026B02Rik

MMRRC Submission

039637-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R1600 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105687809-105828160 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 105778075 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 816 (S816P)

Ref Sequence

ENSEMBL: ENSMUSP00000096040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060896] [ENSMUST00000098441] [ENSMUST00000166431]

AlphaFold

Q8C6K9

Predicted Effect

probably damaging
Transcript: ENSMUST00000060896
AA Change: S816P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000060840
Gene: ENSMUSG00000043719
AA Change: S816P

Domain	Start	End	E-Value	Type
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000098441
AA Change: S816P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: S816P

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	3.3e-9	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166431
AA Change: S816P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: S816P

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	9.3e-10	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Meta Mutation Damage Score

0.4612

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

85% (41/48)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	T	C	14: 54,643,717		probably benign	Het
Acot3	C	T	12: 84,058,710	A317V	probably benign	Het
Ahrr	T	C	13: 74,214,378	D334G	probably benign	Het
Alpk2	C	T	18: 65,378,037	V30M	probably damaging	Het
Arhgef25	G	T	10: 127,185,289	H281N	probably damaging	Het
B3gntl1	A	G	11: 121,630,836	M175T	probably damaging	Het
BC080695	A	G	4: 143,571,967	E160G	possibly damaging	Het
Brca2	T	A	5: 150,560,830		probably benign	Het
Ccnj	A	T	19: 40,844,657		probably benign	Het
Cebpzos	A	G	17: 78,918,388	K11E	probably damaging	Het
Cul4a	A	G	8: 13,123,954	R64G	probably damaging	Het
Cul7	C	A	17: 46,651,822	C126*	probably null	Het
Ercc2	T	C	7: 19,385,941	Y176H	probably benign	Het
Frem2	T	G	3: 53,547,723	D2144A	probably damaging	Het
Gabrg3	A	T	7: 56,735,074	Y246*	probably null	Het
Gm21731	T	C	13: 120,240,833	V55A	probably benign	Het
Gpatch2l	T	C	12: 86,256,934		probably null	Het
Grk1	A	G	8: 13,405,406	T97A	probably benign	Het
Hmcn2	A	G	2: 31,430,787	E4004G	probably damaging	Het
Kcnu1	A	T	8: 25,849,793	R46S	probably damaging	Het
Lrrfip1	T	C	1: 91,114,667	S265P	probably damaging	Het
Lyve1	A	G	7: 110,853,695		probably null	Het
Mme	A	G	3: 63,365,058	Y659C	probably damaging	Het
Mrs2	G	T	13: 24,995,410	N299K	possibly damaging	Het
Mtnr1b	T	C	9: 15,863,319	Y148C	probably damaging	Het
Myo5b	T	A	18: 74,713,540		probably benign	Het
Neb	A	G	2: 52,271,604	Y2059H	probably damaging	Het
Nkain3	T	C	4: 20,469,528		probably benign	Het
Peg10	A	T	6: 4,757,080		probably benign	Het
Rufy2	A	G	10: 63,006,671	T458A	probably benign	Het
Sec14l1	G	A	11: 117,150,604	V448I	probably benign	Het
Tbx19	C	T	1: 165,142,567	G251D	possibly damaging	Het
Trappc9	G	A	15: 72,937,109	Q711*	probably null	Het
Trpm3	A	G	19: 22,139,155	R13G	probably benign	Het
Usp33	G	T	3: 152,379,610	A628S	probably damaging	Het
Vps13a	T	C	19: 16,666,272	N2080S	probably benign	Het
Wdr45b	A	T	11: 121,330,189	I221N	probably damaging	Het
Zfp119a	A	T	17: 55,868,355	W47R	possibly damaging	Het
Zswim9	A	G	7: 13,269,571	C118R	probably damaging	Het

Other mutations in Col6a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Col6a6	APN	9	105758191	critical splice acceptor site	probably null
IGL00768:Col6a6	APN	9	105782412	missense	probably benign	0.04
IGL00917:Col6a6	APN	9	105784254	splice site	probably benign
IGL01385:Col6a6	APN	9	105783666	missense	probably damaging	1.00
IGL01411:Col6a6	APN	9	105785958	nonsense	probably null
IGL01508:Col6a6	APN	9	105727166	splice site	probably benign
IGL01668:Col6a6	APN	9	105709271	missense	probably damaging	1.00
IGL01733:Col6a6	APN	9	105709255	missense	possibly damaging	0.92
IGL01932:Col6a6	APN	9	105689626	missense	probably benign	0.02
IGL01934:Col6a6	APN	9	105698659	critical splice donor site	probably null
IGL01944:Col6a6	APN	9	105783909	missense	probably damaging	1.00
IGL01980:Col6a6	APN	9	105780985	missense	probably damaging	0.96
IGL02114:Col6a6	APN	9	105767199	critical splice donor site	probably null
IGL02129:Col6a6	APN	9	105736340	splice site	probably benign
IGL02201:Col6a6	APN	9	105780995	missense	probably damaging	1.00
IGL02335:Col6a6	APN	9	105784101	missense	probably damaging	1.00
IGL02541:Col6a6	APN	9	105732216	missense	probably benign	0.05
IGL02574:Col6a6	APN	9	105782191	missense	probably damaging	1.00
IGL02649:Col6a6	APN	9	105727170	critical splice donor site	probably null
IGL02852:Col6a6	APN	9	105784073	missense	probably damaging	0.99
IGL03278:Col6a6	APN	9	105709452	missense	probably benign	0.01
IGL03327:Col6a6	APN	9	105767234	missense	possibly damaging	0.90
PIT4519001:Col6a6	UTSW	9	105732263	missense	probably benign	0.23
R0042:Col6a6	UTSW	9	105780697	missense	possibly damaging	0.89
R0046:Col6a6	UTSW	9	105748848	splice site	probably benign
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0140:Col6a6	UTSW	9	105702275	missense	probably damaging	1.00
R0278:Col6a6	UTSW	9	105767288	missense	possibly damaging	0.87
R0281:Col6a6	UTSW	9	105784116	missense	probably benign	0.13
R0382:Col6a6	UTSW	9	105755555	missense	probably damaging	0.98
R0389:Col6a6	UTSW	9	105784204	missense	probably benign	0.02
R0421:Col6a6	UTSW	9	105784206	missense	probably benign	0.02
R0502:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0503:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0600:Col6a6	UTSW	9	105761440	missense	probably damaging	1.00
R0626:Col6a6	UTSW	9	105777744	missense	probably benign	0.45
R0629:Col6a6	UTSW	9	105727165	splice site	probably benign
R0690:Col6a6	UTSW	9	105709486	missense	probably benign	0.01
R1155:Col6a6	UTSW	9	105782090	missense	possibly damaging	0.64
R1245:Col6a6	UTSW	9	105748910	missense	possibly damaging	0.62
R1253:Col6a6	UTSW	9	105774303	missense	probably null	0.98
R1263:Col6a6	UTSW	9	105709489	missense	probably benign	0.01
R1296:Col6a6	UTSW	9	105781091	missense	probably damaging	1.00
R1556:Col6a6	UTSW	9	105709473	missense	possibly damaging	0.82
R1612:Col6a6	UTSW	9	105777549	missense	probably damaging	1.00
R1613:Col6a6	UTSW	9	105732211	critical splice donor site	probably null
R1830:Col6a6	UTSW	9	105702270	missense	probably damaging	0.99
R1858:Col6a6	UTSW	9	105781102	missense	probably damaging	1.00
R1897:Col6a6	UTSW	9	105785744	missense	possibly damaging	0.74
R1944:Col6a6	UTSW	9	105709384	missense	probably damaging	1.00
R2366:Col6a6	UTSW	9	105755694	missense	probably damaging	1.00
R2484:Col6a6	UTSW	9	105780804	missense	probably damaging	0.98
R3079:Col6a6	UTSW	9	105754223	missense	probably benign	0.01
R3176:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3276:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3429:Col6a6	UTSW	9	105777967	missense	probably damaging	1.00
R3716:Col6a6	UTSW	9	105782174	missense	probably damaging	0.98
R3809:Col6a6	UTSW	9	105780692	missense	probably damaging	1.00
R3978:Col6a6	UTSW	9	105698879	missense	probably damaging	0.98
R4087:Col6a6	UTSW	9	105783956	missense	possibly damaging	0.68
R4382:Col6a6	UTSW	9	105783690	missense	probably damaging	1.00
R4516:Col6a6	UTSW	9	105698949	missense	possibly damaging	0.64
R4666:Col6a6	UTSW	9	105767342	missense	possibly damaging	0.93
R4905:Col6a6	UTSW	9	105767424	missense	probably damaging	1.00
R4923:Col6a6	UTSW	9	105788948	missense	probably damaging	1.00
R4951:Col6a6	UTSW	9	105767198	critical splice donor site	probably null
R5002:Col6a6	UTSW	9	105786093	missense	probably benign	0.00
R5111:Col6a6	UTSW	9	105709474	missense	possibly damaging	0.70
R5205:Col6a6	UTSW	9	105782033	missense	probably damaging	0.99
R5399:Col6a6	UTSW	9	105709107	missense	possibly damaging	0.50
R5475:Col6a6	UTSW	9	105774338	missense	probably null	0.79
R5491:Col6a6	UTSW	9	105738236	missense	probably damaging	0.98
R5758:Col6a6	UTSW	9	105761518	critical splice acceptor site	probably null
R5934:Col6a6	UTSW	9	105767075	missense	probably damaging	1.00
R6059:Col6a6	UTSW	9	105783917	missense	probably damaging	1.00
R6284:Col6a6	UTSW	9	105727227	splice site	probably null
R6425:Col6a6	UTSW	9	105698865	missense	probably benign	0.21
R6464:Col6a6	UTSW	9	105788953	start codon destroyed	probably null	0.60
R6469:Col6a6	UTSW	9	105698691	missense	probably damaging	0.97
R6520:Col6a6	UTSW	9	105785825	missense	possibly damaging	0.89
R6552:Col6a6	UTSW	9	105698913	missense	probably damaging	1.00
R6750:Col6a6	UTSW	9	105783680	missense	probably damaging	1.00
R6813:Col6a6	UTSW	9	105783941	missense	probably benign	0.32
R7032:Col6a6	UTSW	9	105767508	missense	probably damaging	0.96
R7260:Col6a6	UTSW	9	105783969	missense	probably benign	0.00
R7472:Col6a6	UTSW	9	105782423	missense	probably damaging	1.00
R7541:Col6a6	UTSW	9	105767324	missense	probably damaging	1.00
R7640:Col6a6	UTSW	9	105785744	missense	possibly damaging	0.74
R7645:Col6a6	UTSW	9	105767198	critical splice donor site	probably null
R7716:Col6a6	UTSW	9	105783903	missense	possibly damaging	0.84
R7866:Col6a6	UTSW	9	105689561	missense	probably damaging	0.96
R7938:Col6a6	UTSW	9	105780684	nonsense	probably null
R8016:Col6a6	UTSW	9	105767528	missense	possibly damaging	0.73
R8043:Col6a6	UTSW	9	105699020	missense	probably damaging	0.98
R8073:Col6a6	UTSW	9	105781947	missense	probably benign	0.01
R8082:Col6a6	UTSW	9	105783930	nonsense	probably null
R8243:Col6a6	UTSW	9	105699269	missense	probably damaging	1.00
R8306:Col6a6	UTSW	9	105784073	missense	probably damaging	0.96
R8324:Col6a6	UTSW	9	105755654	missense	probably benign	0.25
R8384:Col6a6	UTSW	9	105755694	missense	probably damaging	1.00
R8400:Col6a6	UTSW	9	105774796	missense	probably damaging	1.00
R8523:Col6a6	UTSW	9	105774788	missense	possibly damaging	0.71
R8842:Col6a6	UTSW	9	105777967	missense	probably damaging	1.00
R8862:Col6a6	UTSW	9	105786149	missense	probably damaging	1.00
R8907:Col6a6	UTSW	9	105767329	missense	probably damaging	0.99
R9021:Col6a6	UTSW	9	105709546	missense	possibly damaging	0.85
R9088:Col6a6	UTSW	9	105784077	missense	probably damaging	0.99
R9178:Col6a6	UTSW	9	105781970	missense	probably benign	0.30
R9225:Col6a6	UTSW	9	105782238	missense	possibly damaging	0.75
R9340:Col6a6	UTSW	9	105774558	missense	probably damaging	1.00
R9342:Col6a6	UTSW	9	105785973	missense	probably benign	0.00
R9360:Col6a6	UTSW	9	105767487	missense	probably benign	0.00
R9368:Col6a6	UTSW	9	105786101	missense	possibly damaging	0.48
R9398:Col6a6	UTSW	9	105774626	missense	probably benign	0.40
R9450:Col6a6	UTSW	9	105784174	missense	probably benign
R9454:Col6a6	UTSW	9	105783860	missense	probably damaging	0.99
R9458:Col6a6	UTSW	9	105709162	missense	probably benign	0.01
R9563:Col6a6	UTSW	9	105695753	missense	probably benign	0.02
R9568:Col6a6	UTSW	9	105780727	missense	possibly damaging	0.58
R9613:Col6a6	UTSW	9	105739202	missense	probably benign	0.07
R9664:Col6a6	UTSW	9	105781055	missense	probably benign	0.11
R9747:Col6a6	UTSW	9	105784040	missense	probably benign	0.29
R9760:Col6a6	UTSW	9	105782054	missense	probably damaging	0.99
X0022:Col6a6	UTSW	9	105699332	missense	probably damaging	1.00
Z1176:Col6a6	UTSW	9	105780952	missense	probably damaging	1.00
Z1177:Col6a6	UTSW	9	105728255	missense	probably damaging	1.00
Z1177:Col6a6	UTSW	9	105788895	missense	probably null	0.24

Predicted Primers

PCR Primer
(F):5'- TGAAACTACCTCCAGCTTCGTGCC -3'
(R):5'- TCTCCCTTGAACACTACTAAGTACCGC -3'

Sequencing Primer
(F):5'- GTGCCTAGTTCATCCAGGTAAAAC -3'
(R):5'- GTACCGCCAGCACAATAGAG -3'

Posted On

2014-04-24