Incidental Mutation 'R1600:Rufy2'
ID 176099
Institutional Source Beutler Lab
Gene Symbol Rufy2
Ensembl Gene ENSMUSG00000020070
Gene Name RUN and FYVE domain-containing 2
Synonyms 2610111M19Rik, LZ-FYVE, ZFYVE13, Denn
MMRRC Submission 039637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1600 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 62980223-63017210 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63006671 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 458 (T458A)
Ref Sequence ENSEMBL: ENSMUSP00000113429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062600] [ENSMUST00000119567] [ENSMUST00000122231] [ENSMUST00000131718] [ENSMUST00000143594]
AlphaFold Q8R4C2
Predicted Effect probably benign
Transcript: ENSMUST00000062600
SMART Domains Protein: ENSMUSP00000059982
Gene: ENSMUSG00000020070

RUN 105 167 3.02e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119567
AA Change: T458A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113429
Gene: ENSMUSG00000020070
AA Change: T458A

RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 515 N/A INTRINSIC
FYVE 532 599 6.99e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122231
SMART Domains Protein: ENSMUSP00000113754
Gene: ENSMUSG00000020070

Pfam:RUN 45 100 6.2e-9 PFAM
low complexity region 110 123 N/A INTRINSIC
coiled coil region 176 234 N/A INTRINSIC
coiled coil region 292 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131718
SMART Domains Protein: ENSMUSP00000121419
Gene: ENSMUSG00000020070

RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143594
SMART Domains Protein: ENSMUSP00000115339
Gene: ENSMUSG00000020070

RUN 105 167 3.02e-22 SMART
coiled coil region 210 268 N/A INTRINSIC
coiled coil region 326 406 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143726
Meta Mutation Damage Score 0.0581 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 85% (41/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,717 probably benign Het
Acot3 C T 12: 84,058,710 A317V probably benign Het
Ahrr T C 13: 74,214,378 D334G probably benign Het
Alpk2 C T 18: 65,378,037 V30M probably damaging Het
Arhgef25 G T 10: 127,185,289 H281N probably damaging Het
B3gntl1 A G 11: 121,630,836 M175T probably damaging Het
BC080695 A G 4: 143,571,967 E160G possibly damaging Het
Brca2 T A 5: 150,560,830 probably benign Het
Ccnj A T 19: 40,844,657 probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Col6a6 A G 9: 105,778,075 S816P probably damaging Het
Cul4a A G 8: 13,123,954 R64G probably damaging Het
Cul7 C A 17: 46,651,822 C126* probably null Het
Ercc2 T C 7: 19,385,941 Y176H probably benign Het
Frem2 T G 3: 53,547,723 D2144A probably damaging Het
Gabrg3 A T 7: 56,735,074 Y246* probably null Het
Gm21731 T C 13: 120,240,833 V55A probably benign Het
Gpatch2l T C 12: 86,256,934 probably null Het
Grk1 A G 8: 13,405,406 T97A probably benign Het
Hmcn2 A G 2: 31,430,787 E4004G probably damaging Het
Kcnu1 A T 8: 25,849,793 R46S probably damaging Het
Lrrfip1 T C 1: 91,114,667 S265P probably damaging Het
Lyve1 A G 7: 110,853,695 probably null Het
Mme A G 3: 63,365,058 Y659C probably damaging Het
Mrs2 G T 13: 24,995,410 N299K possibly damaging Het
Mtnr1b T C 9: 15,863,319 Y148C probably damaging Het
Myo5b T A 18: 74,713,540 probably benign Het
Neb A G 2: 52,271,604 Y2059H probably damaging Het
Nkain3 T C 4: 20,469,528 probably benign Het
Peg10 A T 6: 4,757,080 probably benign Het
Sec14l1 G A 11: 117,150,604 V448I probably benign Het
Tbx19 C T 1: 165,142,567 G251D possibly damaging Het
Trappc9 G A 15: 72,937,109 Q711* probably null Het
Trpm3 A G 19: 22,139,155 R13G probably benign Het
Usp33 G T 3: 152,379,610 A628S probably damaging Het
Vps13a T C 19: 16,666,272 N2080S probably benign Het
Wdr45b A T 11: 121,330,189 I221N probably damaging Het
Zfp119a A T 17: 55,868,355 W47R possibly damaging Het
Zswim9 A G 7: 13,269,571 C118R probably damaging Het
Other mutations in Rufy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Rufy2 APN 10 62991054 missense probably damaging 0.98
IGL01516:Rufy2 APN 10 63011433 missense possibly damaging 0.82
IGL02811:Rufy2 APN 10 63000327 missense probably damaging 1.00
IGL03244:Rufy2 APN 10 63004704 missense probably benign 0.08
PIT4434001:Rufy2 UTSW 10 62991066 missense possibly damaging 0.60
R0071:Rufy2 UTSW 10 62989167 missense possibly damaging 0.95
R0448:Rufy2 UTSW 10 63004736 missense probably benign
R0496:Rufy2 UTSW 10 62993170 missense probably damaging 1.00
R0723:Rufy2 UTSW 10 62998094 missense probably benign 0.43
R0731:Rufy2 UTSW 10 63011844 critical splice donor site probably benign
R1236:Rufy2 UTSW 10 62994770 missense probably benign 0.36
R1414:Rufy2 UTSW 10 63002199 nonsense probably null
R1626:Rufy2 UTSW 10 62995372 missense probably benign 0.43
R2035:Rufy2 UTSW 10 63006747 missense probably damaging 0.99
R2141:Rufy2 UTSW 10 62990994 missense probably damaging 1.00
R2962:Rufy2 UTSW 10 63000260 missense probably damaging 0.96
R3874:Rufy2 UTSW 10 62998137 missense probably damaging 1.00
R4206:Rufy2 UTSW 10 63004772 nonsense probably null
R4321:Rufy2 UTSW 10 62982680 missense probably damaging 1.00
R4878:Rufy2 UTSW 10 63002211 missense probably damaging 1.00
R5636:Rufy2 UTSW 10 62997954 missense probably damaging 1.00
R7382:Rufy2 UTSW 10 62997969 missense probably benign 0.04
R7714:Rufy2 UTSW 10 63002993 missense probably benign 0.01
R8278:Rufy2 UTSW 10 63007693 missense probably benign 0.27
R8777:Rufy2 UTSW 10 62997881 missense possibly damaging 0.86
R8777-TAIL:Rufy2 UTSW 10 62997881 missense possibly damaging 0.86
R9181:Rufy2 UTSW 10 63000387 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTAATACaggcagagtcaaaaggacca -3'
(R):5'- GCTAACGAGAagtcgggcacag -3'

Sequencing Primer
(F):5'- ccatctgtattgaaatctgactcc -3'
(R):5'- gccttagtcccagcactc -3'
Posted On 2014-04-24