Incidental Mutation 'R1600:Wdr45b'
ID176102
Institutional Source Beutler Lab
Gene Symbol Wdr45b
Ensembl Gene ENSMUSG00000025173
Gene NameWD repeat domain 45B
SynonymsD16Bwg0193e, 0610008N23Rik, Wdr45l
MMRRC Submission 039637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R1600 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location121327224-121354445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121330189 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 221 (I221N)
Ref Sequence ENSEMBL: ENSMUSP00000026173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026173] [ENSMUST00000106110]
Predicted Effect probably damaging
Transcript: ENSMUST00000026173
AA Change: I221N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026173
Gene: ENSMUSG00000025173
AA Change: I221N

DomainStartEndE-ValueType
Blast:WD40 11 37 2e-9 BLAST
low complexity region 70 79 N/A INTRINSIC
Blast:WD40 89 124 6e-11 BLAST
Blast:WD40 128 170 1e-5 BLAST
WD40 174 214 1.38e-2 SMART
WD40 217 258 3.71e-1 SMART
low complexity region 278 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106110
SMART Domains Protein: ENSMUSP00000101716
Gene: ENSMUSG00000025173

DomainStartEndE-ValueType
PDB:4EXV|A 3 205 9e-16 PDB
Blast:WD40 9 37 7e-11 BLAST
SCOP:d1tbga_ 9 205 6e-10 SMART
Blast:WD40 89 124 2e-11 BLAST
Blast:WD40 128 170 2e-6 BLAST
Blast:WD40 174 210 2e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137230
Meta Mutation Damage Score 0.7403 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 85% (41/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WIPI or SVP1 family of WD40 repeat-containing proteins. The protein contains seven WD40 repeats that are thought to fold into a beta-propeller structure that mediates protein-protein interactions, and a conserved motif for interaction with phospholipids. The human genome contains several pseudogenes of this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,717 probably benign Het
Acot3 C T 12: 84,058,710 A317V probably benign Het
Ahrr T C 13: 74,214,378 D334G probably benign Het
Alpk2 C T 18: 65,378,037 V30M probably damaging Het
Arhgef25 G T 10: 127,185,289 H281N probably damaging Het
B3gntl1 A G 11: 121,630,836 M175T probably damaging Het
BC080695 A G 4: 143,571,967 E160G possibly damaging Het
Brca2 T A 5: 150,560,830 probably benign Het
Ccnj A T 19: 40,844,657 probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Col6a6 A G 9: 105,778,075 S816P probably damaging Het
Cul4a A G 8: 13,123,954 R64G probably damaging Het
Cul7 C A 17: 46,651,822 C126* probably null Het
Ercc2 T C 7: 19,385,941 Y176H probably benign Het
Frem2 T G 3: 53,547,723 D2144A probably damaging Het
Gabrg3 A T 7: 56,735,074 Y246* probably null Het
Gm21731 T C 13: 120,240,833 V55A probably benign Het
Gpatch2l T C 12: 86,256,934 probably null Het
Grk1 A G 8: 13,405,406 T97A probably benign Het
Hmcn2 A G 2: 31,430,787 E4004G probably damaging Het
Kcnu1 A T 8: 25,849,793 R46S probably damaging Het
Lrrfip1 T C 1: 91,114,667 S265P probably damaging Het
Lyve1 A G 7: 110,853,695 probably null Het
Mme A G 3: 63,365,058 Y659C probably damaging Het
Mrs2 G T 13: 24,995,410 N299K possibly damaging Het
Mtnr1b T C 9: 15,863,319 Y148C probably damaging Het
Myo5b T A 18: 74,713,540 probably benign Het
Neb A G 2: 52,271,604 Y2059H probably damaging Het
Nkain3 T C 4: 20,469,528 probably benign Het
Peg10 A T 6: 4,757,080 probably benign Het
Rufy2 A G 10: 63,006,671 T458A probably benign Het
Sec14l1 G A 11: 117,150,604 V448I probably benign Het
Tbx19 C T 1: 165,142,567 G251D possibly damaging Het
Trappc9 G A 15: 72,937,109 Q711* probably null Het
Trpm3 A G 19: 22,139,155 R13G probably benign Het
Usp33 G T 3: 152,379,610 A628S probably damaging Het
Vps13a T C 19: 16,666,272 N2080S probably benign Het
Zfp119a A T 17: 55,868,355 W47R possibly damaging Het
Zswim9 A G 7: 13,269,571 C118R probably damaging Het
Other mutations in Wdr45b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02532:Wdr45b APN 11 121328813 missense probably benign 0.00
R0930:Wdr45b UTSW 11 121330214 missense probably damaging 1.00
R1354:Wdr45b UTSW 11 121335430 missense probably damaging 0.98
R4969:Wdr45b UTSW 11 121328824 nonsense probably null
R5133:Wdr45b UTSW 11 121328795 missense probably benign 0.06
R5850:Wdr45b UTSW 11 121331097 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACATCCATGCTGCAACAGGAAAGG -3'
(R):5'- TGCTGTACCTGAGGTAGCAGACAAG -3'

Sequencing Primer
(F):5'- AGAGCCCACGGTGTTCC -3'
(R):5'- GGGGCCAGTGGGTTATAATATAAAT -3'
Posted On2014-04-24