Incidental Mutation 'R1600:B3gntl1'
ID176103
Institutional Source Beutler Lab
Gene Symbol B3gntl1
Ensembl Gene ENSMUSG00000046605
Gene NameUDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Synonyms
MMRRC Submission 039637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R1600 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location121616197-121673153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121630836 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 175 (M175T)
Ref Sequence ENSEMBL: ENSMUSP00000068590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062654] [ENSMUST00000067399]
Predicted Effect probably damaging
Transcript: ENSMUST00000062654
AA Change: M175T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049890
Gene: ENSMUSG00000046605
AA Change: M175T

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 14 244 3e-13 PFAM
Pfam:Glycos_transf_2 17 189 2.2e-24 PFAM
Pfam:Glyco_tranf_2_2 17 237 9.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000067399
AA Change: M175T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068590
Gene: ENSMUSG00000046605
AA Change: M175T

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 14 245 1.4e-10 PFAM
Pfam:Glycos_transf_2 17 189 1.2e-23 PFAM
Pfam:Glyco_tranf_2_2 17 248 2.1e-8 PFAM
Meta Mutation Damage Score 0.3243 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 85% (41/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,717 probably benign Het
Acot3 C T 12: 84,058,710 A317V probably benign Het
Ahrr T C 13: 74,214,378 D334G probably benign Het
Alpk2 C T 18: 65,378,037 V30M probably damaging Het
Arhgef25 G T 10: 127,185,289 H281N probably damaging Het
BC080695 A G 4: 143,571,967 E160G possibly damaging Het
Brca2 T A 5: 150,560,830 probably benign Het
Ccnj A T 19: 40,844,657 probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Col6a6 A G 9: 105,778,075 S816P probably damaging Het
Cul4a A G 8: 13,123,954 R64G probably damaging Het
Cul7 C A 17: 46,651,822 C126* probably null Het
Ercc2 T C 7: 19,385,941 Y176H probably benign Het
Frem2 T G 3: 53,547,723 D2144A probably damaging Het
Gabrg3 A T 7: 56,735,074 Y246* probably null Het
Gm21731 T C 13: 120,240,833 V55A probably benign Het
Gpatch2l T C 12: 86,256,934 probably null Het
Grk1 A G 8: 13,405,406 T97A probably benign Het
Hmcn2 A G 2: 31,430,787 E4004G probably damaging Het
Kcnu1 A T 8: 25,849,793 R46S probably damaging Het
Lrrfip1 T C 1: 91,114,667 S265P probably damaging Het
Lyve1 A G 7: 110,853,695 probably null Het
Mme A G 3: 63,365,058 Y659C probably damaging Het
Mrs2 G T 13: 24,995,410 N299K possibly damaging Het
Mtnr1b T C 9: 15,863,319 Y148C probably damaging Het
Myo5b T A 18: 74,713,540 probably benign Het
Neb A G 2: 52,271,604 Y2059H probably damaging Het
Nkain3 T C 4: 20,469,528 probably benign Het
Peg10 A T 6: 4,757,080 probably benign Het
Rufy2 A G 10: 63,006,671 T458A probably benign Het
Sec14l1 G A 11: 117,150,604 V448I probably benign Het
Tbx19 C T 1: 165,142,567 G251D possibly damaging Het
Trappc9 G A 15: 72,937,109 Q711* probably null Het
Trpm3 A G 19: 22,139,155 R13G probably benign Het
Usp33 G T 3: 152,379,610 A628S probably damaging Het
Vps13a T C 19: 16,666,272 N2080S probably benign Het
Wdr45b A T 11: 121,330,189 I221N probably damaging Het
Zfp119a A T 17: 55,868,355 W47R possibly damaging Het
Zswim9 A G 7: 13,269,571 C118R probably damaging Het
Other mutations in B3gntl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01573:B3gntl1 APN 11 121670963 missense probably damaging 1.00
IGL01640:B3gntl1 APN 11 121673020 missense probably benign
IGL02609:B3gntl1 APN 11 121644601 splice site probably benign
R0370:B3gntl1 UTSW 11 121624154 missense probably damaging 1.00
R0394:B3gntl1 UTSW 11 121619715 missense probably damaging 1.00
R0469:B3gntl1 UTSW 11 121673025 missense probably benign
R0520:B3gntl1 UTSW 11 121623488 missense possibly damaging 0.89
R0541:B3gntl1 UTSW 11 121644604 splice site probably benign
R1460:B3gntl1 UTSW 11 121639798 missense probably damaging 1.00
R1961:B3gntl1 UTSW 11 121644525 critical splice donor site probably null
R4884:B3gntl1 UTSW 11 121629969 missense possibly damaging 0.83
R5779:B3gntl1 UTSW 11 121651676 splice site probably null
R7387:B3gntl1 UTSW 11 121629915 missense possibly damaging 0.87
R7421:B3gntl1 UTSW 11 121624178 missense probably benign 0.18
R7506:B3gntl1 UTSW 11 121670914 missense probably damaging 1.00
R7654:B3gntl1 UTSW 11 121651613 missense probably damaging 1.00
R7715:B3gntl1 UTSW 11 121639796 missense possibly damaging 0.93
R8809:B3gntl1 UTSW 11 121630864 missense possibly damaging 0.83
Z1177:B3gntl1 UTSW 11 121639814 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGCTGGAAAGAGGCTGAATTTCCC -3'
(R):5'- TGCTTAGCAATGCAGAGTGGCGAC -3'

Sequencing Primer
(F):5'- GAGGCTGAATTTCCCAAACTCTG -3'
(R):5'- GAAGTGGCCTCAGTTAATTTCC -3'
Posted On2014-04-24