Incidental Mutation 'R1600:Acot3'
ID176104
Institutional Source Beutler Lab
Gene Symbol Acot3
Ensembl Gene ENSMUSG00000021228
Gene Nameacyl-CoA thioesterase 3
SynonymsPte2a, PTE-Ia
MMRRC Submission 039637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1600 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84052144-84060402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84058710 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 317 (A317V)
Ref Sequence ENSEMBL: ENSMUSP00000112678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021653] [ENSMUST00000120927] [ENSMUST00000223080]
Predicted Effect probably benign
Transcript: ENSMUST00000021653
AA Change: A328V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021653
Gene: ENSMUSG00000021228
AA Change: A328V

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 27 152 7.3e-47 PFAM
low complexity region 158 172 N/A INTRINSIC
Pfam:BAAT_C 214 423 3.7e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120927
AA Change: A317V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112678
Gene: ENSMUSG00000021228
AA Change: A317V

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 15 142 1.9e-39 PFAM
low complexity region 147 161 N/A INTRINSIC
Pfam:BAAT_C 203 412 1.7e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180751
Predicted Effect probably benign
Transcript: ENSMUST00000221229
Predicted Effect probably benign
Transcript: ENSMUST00000223080
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 85% (41/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,717 probably benign Het
Ahrr T C 13: 74,214,378 D334G probably benign Het
Alpk2 C T 18: 65,378,037 V30M probably damaging Het
Arhgef25 G T 10: 127,185,289 H281N probably damaging Het
B3gntl1 A G 11: 121,630,836 M175T probably damaging Het
BC080695 A G 4: 143,571,967 E160G possibly damaging Het
Brca2 T A 5: 150,560,830 probably benign Het
Ccnj A T 19: 40,844,657 probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Col6a6 A G 9: 105,778,075 S816P probably damaging Het
Cul4a A G 8: 13,123,954 R64G probably damaging Het
Cul7 C A 17: 46,651,822 C126* probably null Het
Ercc2 T C 7: 19,385,941 Y176H probably benign Het
Frem2 T G 3: 53,547,723 D2144A probably damaging Het
Gabrg3 A T 7: 56,735,074 Y246* probably null Het
Gm21731 T C 13: 120,240,833 V55A probably benign Het
Gpatch2l T C 12: 86,256,934 probably null Het
Grk1 A G 8: 13,405,406 T97A probably benign Het
Hmcn2 A G 2: 31,430,787 E4004G probably damaging Het
Kcnu1 A T 8: 25,849,793 R46S probably damaging Het
Lrrfip1 T C 1: 91,114,667 S265P probably damaging Het
Lyve1 A G 7: 110,853,695 probably null Het
Mme A G 3: 63,365,058 Y659C probably damaging Het
Mrs2 G T 13: 24,995,410 N299K possibly damaging Het
Mtnr1b T C 9: 15,863,319 Y148C probably damaging Het
Myo5b T A 18: 74,713,540 probably benign Het
Neb A G 2: 52,271,604 Y2059H probably damaging Het
Nkain3 T C 4: 20,469,528 probably benign Het
Peg10 A T 6: 4,757,080 probably benign Het
Rufy2 A G 10: 63,006,671 T458A probably benign Het
Sec14l1 G A 11: 117,150,604 V448I probably benign Het
Tbx19 C T 1: 165,142,567 G251D possibly damaging Het
Trappc9 G A 15: 72,937,109 Q711* probably null Het
Trpm3 A G 19: 22,139,155 R13G probably benign Het
Usp33 G T 3: 152,379,610 A628S probably damaging Het
Vps13a T C 19: 16,666,272 N2080S probably benign Het
Wdr45b A T 11: 121,330,189 I221N probably damaging Het
Zfp119a A T 17: 55,868,355 W47R possibly damaging Het
Zswim9 A G 7: 13,269,571 C118R probably damaging Het
Other mutations in Acot3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Acot3 APN 12 84057089 missense probably benign 0.11
IGL02299:Acot3 APN 12 84058811 nonsense probably null
IGL03407:Acot3 APN 12 84058641 missense probably damaging 0.99
R0557:Acot3 UTSW 12 84058856 missense probably damaging 1.00
R1388:Acot3 UTSW 12 84058987 missense possibly damaging 0.82
R1711:Acot3 UTSW 12 84053573 missense probably damaging 1.00
R1718:Acot3 UTSW 12 84053943 critical splice donor site probably null
R1939:Acot3 UTSW 12 84058551 missense probably benign
R2073:Acot3 UTSW 12 84053456 missense possibly damaging 0.53
R2424:Acot3 UTSW 12 84053864 missense probably damaging 0.98
R4688:Acot3 UTSW 12 84053917 missense probably damaging 0.97
R4739:Acot3 UTSW 12 84058590 missense probably benign 0.00
R5633:Acot3 UTSW 12 84058950 splice site probably null
R6008:Acot3 UTSW 12 84057086 missense probably damaging 1.00
R6746:Acot3 UTSW 12 84053474 missense probably benign
R7017:Acot3 UTSW 12 84053303 start gained probably benign
R8377:Acot3 UTSW 12 84058787 nonsense probably null
X0066:Acot3 UTSW 12 84057038 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGGTAACAGGTTCAGGAGTCG -3'
(R):5'- GTTCAGGGAAGCCTTACACAGTGG -3'

Sequencing Primer
(F):5'- ATGGCTCTATATCCAACATCGG -3'
(R):5'- CTTACACAGTGGGAAGTAAGGAG -3'
Posted On2014-04-24