Mutagenetix > Incidental Mutation

Incidental Mutation 'R1600:Gpatch2l'

176105

Institutional Source

Beutler Lab

Gene Symbol

Gpatch2l

Ensembl Gene

ENSMUSG00000021254

Gene Name

G patch domain containing 2 like

Synonyms

1700020O03Rik

MMRRC Submission

039637-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1600 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86241858-86291784 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 86256934 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000152284 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071106] [ENSMUST00000071106] [ENSMUST00000221368]

AlphaFold

Q6PE65

Predicted Effect

probably null
Transcript: ENSMUST00000071106

SMART Domains

Protein: ENSMUSP00000065858
Gene: ENSMUSG00000021254

Domain	Start	End	E-Value	Type
low complexity region	33	48	N/A	INTRINSIC
low complexity region	127	135	N/A	INTRINSIC
low complexity region	219	232	N/A	INTRINSIC
low complexity region	413	427	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000071106

SMART Domains

Protein: ENSMUSP00000065858
Gene: ENSMUSG00000021254

Domain	Start	End	E-Value	Type
low complexity region	33	48	N/A	INTRINSIC
low complexity region	127	135	N/A	INTRINSIC
low complexity region	219	232	N/A	INTRINSIC
low complexity region	413	427	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220646

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220810

Predicted Effect

probably null
Transcript: ENSMUST00000221368

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222299

Meta Mutation Damage Score

0.9501

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

85% (41/48)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	T	C	14: 54,643,717		probably benign	Het
Acot3	C	T	12: 84,058,710	A317V	probably benign	Het
Ahrr	T	C	13: 74,214,378	D334G	probably benign	Het
Alpk2	C	T	18: 65,378,037	V30M	probably damaging	Het
Arhgef25	G	T	10: 127,185,289	H281N	probably damaging	Het
B3gntl1	A	G	11: 121,630,836	M175T	probably damaging	Het
BC080695	A	G	4: 143,571,967	E160G	possibly damaging	Het
Brca2	T	A	5: 150,560,830		probably benign	Het
Ccnj	A	T	19: 40,844,657		probably benign	Het
Cebpzos	A	G	17: 78,918,388	K11E	probably damaging	Het
Col6a6	A	G	9: 105,778,075	S816P	probably damaging	Het
Cul4a	A	G	8: 13,123,954	R64G	probably damaging	Het
Cul7	C	A	17: 46,651,822	C126*	probably null	Het
Ercc2	T	C	7: 19,385,941	Y176H	probably benign	Het
Frem2	T	G	3: 53,547,723	D2144A	probably damaging	Het
Gabrg3	A	T	7: 56,735,074	Y246*	probably null	Het
Gm21731	T	C	13: 120,240,833	V55A	probably benign	Het
Grk1	A	G	8: 13,405,406	T97A	probably benign	Het
Hmcn2	A	G	2: 31,430,787	E4004G	probably damaging	Het
Kcnu1	A	T	8: 25,849,793	R46S	probably damaging	Het
Lrrfip1	T	C	1: 91,114,667	S265P	probably damaging	Het
Lyve1	A	G	7: 110,853,695		probably null	Het
Mme	A	G	3: 63,365,058	Y659C	probably damaging	Het
Mrs2	G	T	13: 24,995,410	N299K	possibly damaging	Het
Mtnr1b	T	C	9: 15,863,319	Y148C	probably damaging	Het
Myo5b	T	A	18: 74,713,540		probably benign	Het
Neb	A	G	2: 52,271,604	Y2059H	probably damaging	Het
Nkain3	T	C	4: 20,469,528		probably benign	Het
Peg10	A	T	6: 4,757,080		probably benign	Het
Rufy2	A	G	10: 63,006,671	T458A	probably benign	Het
Sec14l1	G	A	11: 117,150,604	V448I	probably benign	Het
Tbx19	C	T	1: 165,142,567	G251D	possibly damaging	Het
Trappc9	G	A	15: 72,937,109	Q711*	probably null	Het
Trpm3	A	G	19: 22,139,155	R13G	probably benign	Het
Usp33	G	T	3: 152,379,610	A628S	probably damaging	Het
Vps13a	T	C	19: 16,666,272	N2080S	probably benign	Het
Wdr45b	A	T	11: 121,330,189	I221N	probably damaging	Het
Zfp119a	A	T	17: 55,868,355	W47R	possibly damaging	Het
Zswim9	A	G	7: 13,269,571	C118R	probably damaging	Het

Other mutations in Gpatch2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02335:Gpatch2l	APN	12	86256937	splice site	probably benign
IGL02458:Gpatch2l	APN	12	86288961	utr 3 prime	probably benign
IGL03131:Gpatch2l	APN	12	86281511	missense	probably benign	0.00
R0546:Gpatch2l	UTSW	12	86288848	makesense	probably null
R1349:Gpatch2l	UTSW	12	86260709	missense	possibly damaging	0.94
R1368:Gpatch2l	UTSW	12	86260665	missense	possibly damaging	0.73
R1701:Gpatch2l	UTSW	12	86288952	missense	probably benign	0.00
R2656:Gpatch2l	UTSW	12	86288810	missense	probably damaging	1.00
R3149:Gpatch2l	UTSW	12	86244315	missense	possibly damaging	0.76
R3150:Gpatch2l	UTSW	12	86244315	missense	possibly damaging	0.76
R3176:Gpatch2l	UTSW	12	86244315	missense	possibly damaging	0.76
R3177:Gpatch2l	UTSW	12	86244315	missense	possibly damaging	0.76
R3276:Gpatch2l	UTSW	12	86244315	missense	possibly damaging	0.76
R3277:Gpatch2l	UTSW	12	86244315	missense	possibly damaging	0.76
R4342:Gpatch2l	UTSW	12	86260679	missense	probably benign	0.00
R5161:Gpatch2l	UTSW	12	86267176	missense	probably benign	0.17
R5712:Gpatch2l	UTSW	12	86244480	missense	probably damaging	1.00
R6343:Gpatch2l	UTSW	12	86260605	nonsense	probably null
R6899:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6910:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6911:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6912:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6917:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6930:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6994:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6995:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6996:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6998:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6999:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R7000:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R7001:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R7002:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R7003:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R7010:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R7011:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R7203:Gpatch2l	UTSW	12	86288937	missense	probably benign	0.40
R7239:Gpatch2l	UTSW	12	86260575	critical splice acceptor site	probably null
R7327:Gpatch2l	UTSW	12	86256872	missense	probably damaging	1.00
R7419:Gpatch2l	UTSW	12	86265251	critical splice donor site	probably null
R8231:Gpatch2l	UTSW	12	86244189	missense	probably damaging	1.00
R8876:Gpatch2l	UTSW	12	86261631	missense	probably damaging	0.99
R9189:Gpatch2l	UTSW	12	86244378	missense	probably benign	0.13
R9284:Gpatch2l	UTSW	12	86244109	missense	probably benign	0.01
R9432:Gpatch2l	UTSW	12	86260634	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGCTAATGGGCTGAAGTGCAGTTAC -3'
(R):5'- GTCCCAAAGCTGGAACCAAGAGTG -3'

Sequencing Primer
(F):5'- CAGTTACAGAGACAGTTGGAATATCC -3'
(R):5'- agttaagagtgtggtcttccag -3'

Posted On

2014-04-24