Incidental Mutation 'R1600:Gpatch2l'
ID 176105
Institutional Source Beutler Lab
Gene Symbol Gpatch2l
Ensembl Gene ENSMUSG00000021254
Gene Name G patch domain containing 2 like
Synonyms 1700020O03Rik
MMRRC Submission 039637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1600 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 86241858-86291784 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 86256934 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071106] [ENSMUST00000071106] [ENSMUST00000221368]
AlphaFold Q6PE65
Predicted Effect probably null
Transcript: ENSMUST00000071106
SMART Domains Protein: ENSMUSP00000065858
Gene: ENSMUSG00000021254

low complexity region 33 48 N/A INTRINSIC
low complexity region 127 135 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 413 427 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000071106
SMART Domains Protein: ENSMUSP00000065858
Gene: ENSMUSG00000021254

low complexity region 33 48 N/A INTRINSIC
low complexity region 127 135 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 413 427 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220810
Predicted Effect probably null
Transcript: ENSMUST00000221368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222299
Meta Mutation Damage Score 0.9501 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 85% (41/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,717 probably benign Het
Acot3 C T 12: 84,058,710 A317V probably benign Het
Ahrr T C 13: 74,214,378 D334G probably benign Het
Alpk2 C T 18: 65,378,037 V30M probably damaging Het
Arhgef25 G T 10: 127,185,289 H281N probably damaging Het
B3gntl1 A G 11: 121,630,836 M175T probably damaging Het
BC080695 A G 4: 143,571,967 E160G possibly damaging Het
Brca2 T A 5: 150,560,830 probably benign Het
Ccnj A T 19: 40,844,657 probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Col6a6 A G 9: 105,778,075 S816P probably damaging Het
Cul4a A G 8: 13,123,954 R64G probably damaging Het
Cul7 C A 17: 46,651,822 C126* probably null Het
Ercc2 T C 7: 19,385,941 Y176H probably benign Het
Frem2 T G 3: 53,547,723 D2144A probably damaging Het
Gabrg3 A T 7: 56,735,074 Y246* probably null Het
Gm21731 T C 13: 120,240,833 V55A probably benign Het
Grk1 A G 8: 13,405,406 T97A probably benign Het
Hmcn2 A G 2: 31,430,787 E4004G probably damaging Het
Kcnu1 A T 8: 25,849,793 R46S probably damaging Het
Lrrfip1 T C 1: 91,114,667 S265P probably damaging Het
Lyve1 A G 7: 110,853,695 probably null Het
Mme A G 3: 63,365,058 Y659C probably damaging Het
Mrs2 G T 13: 24,995,410 N299K possibly damaging Het
Mtnr1b T C 9: 15,863,319 Y148C probably damaging Het
Myo5b T A 18: 74,713,540 probably benign Het
Neb A G 2: 52,271,604 Y2059H probably damaging Het
Nkain3 T C 4: 20,469,528 probably benign Het
Peg10 A T 6: 4,757,080 probably benign Het
Rufy2 A G 10: 63,006,671 T458A probably benign Het
Sec14l1 G A 11: 117,150,604 V448I probably benign Het
Tbx19 C T 1: 165,142,567 G251D possibly damaging Het
Trappc9 G A 15: 72,937,109 Q711* probably null Het
Trpm3 A G 19: 22,139,155 R13G probably benign Het
Usp33 G T 3: 152,379,610 A628S probably damaging Het
Vps13a T C 19: 16,666,272 N2080S probably benign Het
Wdr45b A T 11: 121,330,189 I221N probably damaging Het
Zfp119a A T 17: 55,868,355 W47R possibly damaging Het
Zswim9 A G 7: 13,269,571 C118R probably damaging Het
Other mutations in Gpatch2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02335:Gpatch2l APN 12 86256937 splice site probably benign
IGL02458:Gpatch2l APN 12 86288961 utr 3 prime probably benign
IGL03131:Gpatch2l APN 12 86281511 missense probably benign 0.00
R0546:Gpatch2l UTSW 12 86288848 makesense probably null
R1349:Gpatch2l UTSW 12 86260709 missense possibly damaging 0.94
R1368:Gpatch2l UTSW 12 86260665 missense possibly damaging 0.73
R1701:Gpatch2l UTSW 12 86288952 missense probably benign 0.00
R2656:Gpatch2l UTSW 12 86288810 missense probably damaging 1.00
R3149:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3150:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3176:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3177:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3276:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3277:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R4342:Gpatch2l UTSW 12 86260679 missense probably benign 0.00
R5161:Gpatch2l UTSW 12 86267176 missense probably benign 0.17
R5712:Gpatch2l UTSW 12 86244480 missense probably damaging 1.00
R6343:Gpatch2l UTSW 12 86260605 nonsense probably null
R6899:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6910:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6911:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6912:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6917:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6930:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6994:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6995:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6996:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6998:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6999:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7000:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7001:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7002:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7003:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7010:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7011:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7203:Gpatch2l UTSW 12 86288937 missense probably benign 0.40
R7239:Gpatch2l UTSW 12 86260575 critical splice acceptor site probably null
R7327:Gpatch2l UTSW 12 86256872 missense probably damaging 1.00
R7419:Gpatch2l UTSW 12 86265251 critical splice donor site probably null
R8231:Gpatch2l UTSW 12 86244189 missense probably damaging 1.00
R8876:Gpatch2l UTSW 12 86261631 missense probably damaging 0.99
R9189:Gpatch2l UTSW 12 86244378 missense probably benign 0.13
R9284:Gpatch2l UTSW 12 86244109 missense probably benign 0.01
R9432:Gpatch2l UTSW 12 86260634 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- agttaagagtgtggtcttccag -3'
Posted On 2014-04-24