Incidental Mutation 'R1600:Mrs2'
ID176107
Institutional Source Beutler Lab
Gene Symbol Mrs2
Ensembl Gene ENSMUSG00000021339
Gene NameMRS2 magnesium transporter
SynonymsMrs2l, LOC380836
MMRRC Submission 039637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1600 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location24987483-25020379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24995410 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 299 (N299K)
Ref Sequence ENSEMBL: ENSMUSP00000021772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021772] [ENSMUST00000021773]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021772
AA Change: N299K

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021772
Gene: ENSMUSG00000021339
AA Change: N299K

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
coiled coil region 323 359 N/A INTRINSIC
transmembrane domain 374 396 N/A INTRINSIC
transmembrane domain 409 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021773
SMART Domains Protein: ENSMUSP00000021773
Gene: ENSMUSG00000021340

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Zn_dep_PLPC 28 219 9.8e-28 PFAM
Int_alpha 377 435 7.21e-11 SMART
Int_alpha 446 503 7.43e-13 SMART
Int_alpha 509 565 7.86e-3 SMART
Int_alpha 576 643 4.09e0 SMART
Blast:Int_alpha 644 708 2e-24 BLAST
Int_alpha 716 774 1.86e-4 SMART
Blast:Int_alpha 789 837 1e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225296
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 85% (41/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,717 probably benign Het
Acot3 C T 12: 84,058,710 A317V probably benign Het
Ahrr T C 13: 74,214,378 D334G probably benign Het
Alpk2 C T 18: 65,378,037 V30M probably damaging Het
Arhgef25 G T 10: 127,185,289 H281N probably damaging Het
B3gntl1 A G 11: 121,630,836 M175T probably damaging Het
BC080695 A G 4: 143,571,967 E160G possibly damaging Het
Brca2 T A 5: 150,560,830 probably benign Het
Ccnj A T 19: 40,844,657 probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Col6a6 A G 9: 105,778,075 S816P probably damaging Het
Cul4a A G 8: 13,123,954 R64G probably damaging Het
Cul7 C A 17: 46,651,822 C126* probably null Het
Ercc2 T C 7: 19,385,941 Y176H probably benign Het
Frem2 T G 3: 53,547,723 D2144A probably damaging Het
Gabrg3 A T 7: 56,735,074 Y246* probably null Het
Gm21731 T C 13: 120,240,833 V55A probably benign Het
Gpatch2l T C 12: 86,256,934 probably null Het
Grk1 A G 8: 13,405,406 T97A probably benign Het
Hmcn2 A G 2: 31,430,787 E4004G probably damaging Het
Kcnu1 A T 8: 25,849,793 R46S probably damaging Het
Lrrfip1 T C 1: 91,114,667 S265P probably damaging Het
Lyve1 A G 7: 110,853,695 probably null Het
Mme A G 3: 63,365,058 Y659C probably damaging Het
Mtnr1b T C 9: 15,863,319 Y148C probably damaging Het
Myo5b T A 18: 74,713,540 probably benign Het
Neb A G 2: 52,271,604 Y2059H probably damaging Het
Nkain3 T C 4: 20,469,528 probably benign Het
Peg10 A T 6: 4,757,080 probably benign Het
Rufy2 A G 10: 63,006,671 T458A probably benign Het
Sec14l1 G A 11: 117,150,604 V448I probably benign Het
Tbx19 C T 1: 165,142,567 G251D possibly damaging Het
Trappc9 G A 15: 72,937,109 Q711* probably null Het
Trpm3 A G 19: 22,139,155 R13G probably benign Het
Usp33 G T 3: 152,379,610 A628S probably damaging Het
Vps13a T C 19: 16,666,272 N2080S probably benign Het
Wdr45b A T 11: 121,330,189 I221N probably damaging Het
Zfp119a A T 17: 55,868,355 W47R possibly damaging Het
Zswim9 A G 7: 13,269,571 C118R probably damaging Het
Other mutations in Mrs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02323:Mrs2 APN 13 25004957 missense probably damaging 1.00
R0201:Mrs2 UTSW 13 25018534 missense probably benign 0.02
R0371:Mrs2 UTSW 13 24993095 missense probably benign
R0669:Mrs2 UTSW 13 24993759 missense possibly damaging 0.76
R1496:Mrs2 UTSW 13 25005034 missense probably benign 0.01
R1796:Mrs2 UTSW 13 24997128 missense possibly damaging 0.82
R3964:Mrs2 UTSW 13 25001763 missense possibly damaging 0.52
R4639:Mrs2 UTSW 13 25001784 missense probably damaging 0.96
R4837:Mrs2 UTSW 13 24999057 critical splice acceptor site probably null
R6953:Mrs2 UTSW 13 25001788 missense probably benign 0.02
R7055:Mrs2 UTSW 13 25004954 missense probably benign
R7752:Mrs2 UTSW 13 25018566 missense possibly damaging 0.65
R7877:Mrs2 UTSW 13 24997130 missense probably damaging 1.00
R7901:Mrs2 UTSW 13 25018566 missense possibly damaging 0.65
R7980:Mrs2 UTSW 13 25020238 missense possibly damaging 0.93
R8177:Mrs2 UTSW 13 25004978 missense probably benign 0.00
R8879:Mrs2 UTSW 13 25001784 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGCTTTAGCCAGGCCATAGGTAAC -3'
(R):5'- GCTCACAAATGGGATGCAGTCACAG -3'

Sequencing Primer
(F):5'- TAAAGCCCACTGGAGTAGTCC -3'
(R):5'- TGCAGTCACAGCAGGTG -3'
Posted On2014-04-24