Incidental Mutation 'R1601:Prox1'
ID176124
Institutional Source Beutler Lab
Gene Symbol Prox1
Ensembl Gene ENSMUSG00000010175
Gene Nameprospero homeobox 1
SynonymsA230003G05Rik
MMRRC Submission 039638-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1601 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location190118035-190170714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 190161006 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 414 (D414G)
Ref Sequence ENSEMBL: ENSMUSP00000135066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010319] [ENSMUST00000175916] [ENSMUST00000177288]
Predicted Effect probably damaging
Transcript: ENSMUST00000010319
AA Change: D414G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000010319
Gene: ENSMUSG00000010175
AA Change: D414G

DomainStartEndE-ValueType
low complexity region 208 223 N/A INTRINSIC
SCOP:d1fxkc_ 227 363 9e-5 SMART
low complexity region 514 526 N/A INTRINSIC
low complexity region 529 545 N/A INTRINSIC
Pfam:HPD 578 735 8.9e-91 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175916
AA Change: D414G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135703
Gene: ENSMUSG00000010175
AA Change: D414G

DomainStartEndE-ValueType
low complexity region 208 223 N/A INTRINSIC
SCOP:d1fxkc_ 227 363 9e-5 SMART
low complexity region 514 526 N/A INTRINSIC
low complexity region 529 545 N/A INTRINSIC
Pfam:HPD 578 735 8.9e-91 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177288
AA Change: D414G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135066
Gene: ENSMUSG00000010175
AA Change: D414G

DomainStartEndE-ValueType
low complexity region 208 223 N/A INTRINSIC
SCOP:d1fxkc_ 227 363 9e-5 SMART
low complexity region 514 526 N/A INTRINSIC
low complexity region 529 545 N/A INTRINSIC
Pfam:HPD 579 732 2.2e-86 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the homeobox transcription factor family. Members of this family contain a homeobox domain that consists of a 60-amino acid helix-turn-helix structure that binds DNA and RNA. The protein encoded by this gene is conserved across vertebrates and may play an essential role during development. Altered levels of this protein have been reported in cancers of different organs, such as colon, brain, blood, breast, pancreas, liver and esophagus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality with impaired development of the lens, lymphatic system, liver and pancreas. Heterozygous mutation results in early postnatal lethality with varying penetrance on different genetic backgrounds, obesity and lymphatic vessel abnormalities [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4933416C03Rik T C 10: 116,113,616 S2G probably damaging Het
Adgra2 T C 8: 27,110,018 probably null Het
Adgrb2 T C 4: 129,992,837 S257P probably benign Het
Adgre1 A G 17: 57,441,353 K518E probably benign Het
Anxa7 A T 14: 20,464,615 Y64* probably null Het
Arhgef7 A G 8: 11,782,638 probably null Het
Cdc42bpa T A 1: 180,065,001 Y243* probably null Het
Cdk14 C T 5: 5,135,378 V176M probably damaging Het
Cnbd2 A G 2: 156,333,631 E54G probably damaging Het
Crx T C 7: 15,867,811 probably null Het
Cyp24a1 A G 2: 170,485,691 F511L possibly damaging Het
Ddx11 A G 17: 66,150,385 M810V probably damaging Het
Dock10 T C 1: 80,549,802 T1077A probably benign Het
Dopey1 G A 9: 86,536,250 D2011N probably damaging Het
Ehhadh T A 16: 21,766,408 H241L probably benign Het
Enah A T 1: 181,919,620 L523* probably null Het
Fabp3 T C 4: 130,308,848 L24P probably benign Het
Fat2 A G 11: 55,282,010 S2626P probably benign Het
Fbxo4 A G 15: 3,968,965 M337T possibly damaging Het
Gas6 G T 8: 13,465,786 T662N probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hrh4 G A 18: 13,015,898 V106I possibly damaging Het
Ido2 G T 8: 24,576,189 H20Q possibly damaging Het
Ikbkap T A 4: 56,774,756 K740* probably null Het
Itga10 G T 3: 96,653,658 R613L possibly damaging Het
Itsn2 T C 12: 4,658,452 S836P probably benign Het
Kcng3 A T 17: 83,588,339 C233S probably damaging Het
Kdm3b A G 18: 34,808,731 Q625R probably damaging Het
Kidins220 A G 12: 25,005,088 S553G probably benign Het
Krt82 A T 15: 101,545,153 I266N probably damaging Het
Lama5 A T 2: 180,197,745 L736Q probably damaging Het
Lnx2 A G 5: 147,033,519 C138R probably damaging Het
Mcm5 T C 8: 75,119,354 C397R possibly damaging Het
Me1 A C 9: 86,678,012 Y52D probably damaging Het
Muc4 C A 16: 32,755,501 probably benign Het
Myo18b G T 5: 112,871,498 Q638K possibly damaging Het
Ncapd2 A G 6: 125,185,772 L170P probably damaging Het
Neb A T 2: 52,287,252 L1359* probably null Het
Nomo1 C A 7: 46,046,955 S299Y probably damaging Het
Olfr1359 C A 13: 21,703,226 T75K probably damaging Het
Olfr1509 A C 14: 52,450,442 T10P probably benign Het
Olfr322 A T 11: 58,666,077 R173W probably damaging Het
Olfr57 A T 10: 79,035,504 Y236F possibly damaging Het
Onecut1 A T 9: 74,862,691 H132L probably benign Het
Paqr3 A G 5: 97,111,389 Y19H probably benign Het
Prdx5 T C 19: 6,907,558 H140R possibly damaging Het
Ptprh T G 7: 4,552,638 E774A probably damaging Het
Rnpepl1 A T 1: 92,917,222 D412V possibly damaging Het
Sars2 C T 7: 28,748,971 T259M probably benign Het
Sbf2 T C 7: 110,340,076 probably null Het
Sbno2 C T 10: 80,060,492 R898H probably damaging Het
Smox C A 2: 131,520,174 T172N probably damaging Het
Tdrd9 C T 12: 112,023,253 R341* probably null Het
Thrap3 C G 4: 126,180,101 G284A probably damaging Het
Tmtc4 A G 14: 122,944,826 V271A probably benign Het
Trank1 A G 9: 111,373,477 T1637A probably damaging Het
Tspan5 T A 3: 138,896,835 I166N probably damaging Het
Vps13b T C 15: 35,642,436 V1398A probably benign Het
Xbp1 C T 11: 5,521,975 R34W probably damaging Het
Other mutations in Prox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Prox1 APN 1 190123410 splice site probably benign
IGL01729:Prox1 APN 1 190161175 missense probably benign
IGL02167:Prox1 APN 1 190161280 missense probably benign 0.13
IGL02416:Prox1 APN 1 190161130 missense probably benign 0.00
IGL02419:Prox1 APN 1 190161130 missense probably benign 0.00
IGL03234:Prox1 APN 1 190161636 missense probably damaging 1.00
R0069:Prox1 UTSW 1 190160919 missense possibly damaging 0.85
R0514:Prox1 UTSW 1 190161456 missense probably damaging 0.99
R1249:Prox1 UTSW 1 190147061 missense possibly damaging 0.94
R1299:Prox1 UTSW 1 190146943 splice site probably benign
R1893:Prox1 UTSW 1 190160518 splice site probably benign
R2090:Prox1 UTSW 1 190160812 missense probably damaging 0.99
R2366:Prox1 UTSW 1 190161882 missense probably damaging 0.96
R4614:Prox1 UTSW 1 190162008 missense probably damaging 0.99
R4799:Prox1 UTSW 1 190153472 missense probably damaging 0.98
R4873:Prox1 UTSW 1 190162122 missense probably damaging 0.99
R4875:Prox1 UTSW 1 190162122 missense probably damaging 0.99
R5124:Prox1 UTSW 1 190161279 missense possibly damaging 0.73
R5149:Prox1 UTSW 1 190147053 missense possibly damaging 0.89
R5256:Prox1 UTSW 1 190161441 missense probably benign 0.02
R5545:Prox1 UTSW 1 190147142 missense probably damaging 1.00
R5985:Prox1 UTSW 1 190146955 missense possibly damaging 0.93
R5993:Prox1 UTSW 1 190162239 missense probably damaging 1.00
R6833:Prox1 UTSW 1 190160778 missense probably damaging 0.99
R7335:Prox1 UTSW 1 190161845 missense possibly damaging 0.93
R7385:Prox1 UTSW 1 190162126 missense probably benign
R7572:Prox1 UTSW 1 190123386 missense probably benign 0.10
R7608:Prox1 UTSW 1 190153445 missense probably benign 0.24
R7655:Prox1 UTSW 1 190162221 missense probably damaging 0.99
R7656:Prox1 UTSW 1 190162221 missense probably damaging 0.99
Z1088:Prox1 UTSW 1 190161999 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCCGAGTCAAGTCTAAGGACTCAG -3'
(R):5'- GACACGGTGGTCAAAGTCTTCTCAG -3'

Sequencing Primer
(F):5'- GCACCTAGTGGACTCTGAAATG -3'
(R):5'- GGTCAAAGTCTTCTCAGCCAAAC -3'
Posted On2014-04-24