Incidental Mutation 'R1601:Cyp24a1'
ID176129
Institutional Source Beutler Lab
Gene Symbol Cyp24a1
Ensembl Gene ENSMUSG00000038567
Gene Namecytochrome P450, family 24, subfamily a, polypeptide 1
SynonymsCP24, 24-OHase, Cyp24, 25-hydroxyvitamin D-24-hydroxylase
MMRRC Submission 039638-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1601 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location170482708-170497145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 170485691 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 511 (F511L)
Ref Sequence ENSEMBL: ENSMUSP00000047954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038824]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038824
AA Change: F511L

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047954
Gene: ENSMUSG00000038567
AA Change: F511L

DomainStartEndE-ValueType
Pfam:p450 58 511 6e-108 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene localizes to the mitochondrion, where it degrades calcitriol to calcitetrol. This gene is upregulated by binding of calcitriol to the upstream regulatory region and to a downstream enhancer region, thereby allowing calcitriol to autoregulate its concentration in the cell. The encoded protein may also play a role in calcium homeostasis. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruption of this gene suffer a 50% mortality rate between birth and weaning. abnormalities are seen in the development of membranous bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4933416C03Rik T C 10: 116,113,616 S2G probably damaging Het
Adgra2 T C 8: 27,110,018 probably null Het
Adgrb2 T C 4: 129,992,837 S257P probably benign Het
Adgre1 A G 17: 57,441,353 K518E probably benign Het
Anxa7 A T 14: 20,464,615 Y64* probably null Het
Arhgef7 A G 8: 11,782,638 probably null Het
Cdc42bpa T A 1: 180,065,001 Y243* probably null Het
Cdk14 C T 5: 5,135,378 V176M probably damaging Het
Cnbd2 A G 2: 156,333,631 E54G probably damaging Het
Crx T C 7: 15,867,811 probably null Het
Ddx11 A G 17: 66,150,385 M810V probably damaging Het
Dock10 T C 1: 80,549,802 T1077A probably benign Het
Dopey1 G A 9: 86,536,250 D2011N probably damaging Het
Ehhadh T A 16: 21,766,408 H241L probably benign Het
Enah A T 1: 181,919,620 L523* probably null Het
Fabp3 T C 4: 130,308,848 L24P probably benign Het
Fat2 A G 11: 55,282,010 S2626P probably benign Het
Fbxo4 A G 15: 3,968,965 M337T possibly damaging Het
Gas6 G T 8: 13,465,786 T662N probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hrh4 G A 18: 13,015,898 V106I possibly damaging Het
Ido2 G T 8: 24,576,189 H20Q possibly damaging Het
Ikbkap T A 4: 56,774,756 K740* probably null Het
Itga10 G T 3: 96,653,658 R613L possibly damaging Het
Itsn2 T C 12: 4,658,452 S836P probably benign Het
Kcng3 A T 17: 83,588,339 C233S probably damaging Het
Kdm3b A G 18: 34,808,731 Q625R probably damaging Het
Kidins220 A G 12: 25,005,088 S553G probably benign Het
Krt82 A T 15: 101,545,153 I266N probably damaging Het
Lama5 A T 2: 180,197,745 L736Q probably damaging Het
Lnx2 A G 5: 147,033,519 C138R probably damaging Het
Mcm5 T C 8: 75,119,354 C397R possibly damaging Het
Me1 A C 9: 86,678,012 Y52D probably damaging Het
Muc4 C A 16: 32,755,501 probably benign Het
Myo18b G T 5: 112,871,498 Q638K possibly damaging Het
Ncapd2 A G 6: 125,185,772 L170P probably damaging Het
Neb A T 2: 52,287,252 L1359* probably null Het
Nomo1 C A 7: 46,046,955 S299Y probably damaging Het
Olfr1359 C A 13: 21,703,226 T75K probably damaging Het
Olfr1509 A C 14: 52,450,442 T10P probably benign Het
Olfr322 A T 11: 58,666,077 R173W probably damaging Het
Olfr57 A T 10: 79,035,504 Y236F possibly damaging Het
Onecut1 A T 9: 74,862,691 H132L probably benign Het
Paqr3 A G 5: 97,111,389 Y19H probably benign Het
Prdx5 T C 19: 6,907,558 H140R possibly damaging Het
Prox1 T C 1: 190,161,006 D414G probably damaging Het
Ptprh T G 7: 4,552,638 E774A probably damaging Het
Rnpepl1 A T 1: 92,917,222 D412V possibly damaging Het
Sars2 C T 7: 28,748,971 T259M probably benign Het
Sbf2 T C 7: 110,340,076 probably null Het
Sbno2 C T 10: 80,060,492 R898H probably damaging Het
Smox C A 2: 131,520,174 T172N probably damaging Het
Tdrd9 C T 12: 112,023,253 R341* probably null Het
Thrap3 C G 4: 126,180,101 G284A probably damaging Het
Tmtc4 A G 14: 122,944,826 V271A probably benign Het
Trank1 A G 9: 111,373,477 T1637A probably damaging Het
Tspan5 T A 3: 138,896,835 I166N probably damaging Het
Vps13b T C 15: 35,642,436 V1398A probably benign Het
Xbp1 C T 11: 5,521,975 R34W probably damaging Het
Other mutations in Cyp24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cyp24a1 APN 2 170496566 missense probably damaging 1.00
IGL02187:Cyp24a1 APN 2 170494093 missense probably damaging 1.00
IGL02269:Cyp24a1 APN 2 170496572 missense probably damaging 1.00
IGL02273:Cyp24a1 APN 2 170496358 missense probably damaging 1.00
IGL03089:Cyp24a1 APN 2 170485966 missense probably damaging 1.00
R0359:Cyp24a1 UTSW 2 170491699 missense possibly damaging 0.94
R1037:Cyp24a1 UTSW 2 170491617 missense probably damaging 1.00
R1243:Cyp24a1 UTSW 2 170495406 missense probably benign 0.28
R1696:Cyp24a1 UTSW 2 170486043 missense probably benign 0.10
R1839:Cyp24a1 UTSW 2 170496741 missense probably benign
R1845:Cyp24a1 UTSW 2 170487917 missense probably benign 0.06
R4832:Cyp24a1 UTSW 2 170496178 missense probably benign 0.07
R5649:Cyp24a1 UTSW 2 170496309 missense possibly damaging 0.87
R6320:Cyp24a1 UTSW 2 170486784 missense probably benign 0.13
R6668:Cyp24a1 UTSW 2 170485885 critical splice donor site probably null
R6823:Cyp24a1 UTSW 2 170487979 missense probably benign 0.12
R6953:Cyp24a1 UTSW 2 170487946 missense probably benign
R7136:Cyp24a1 UTSW 2 170494143 missense probably benign 0.15
R7287:Cyp24a1 UTSW 2 170485906 missense probably damaging 1.00
R7831:Cyp24a1 UTSW 2 170485940 missense probably damaging 1.00
R7893:Cyp24a1 UTSW 2 170496516 critical splice donor site probably null
R7914:Cyp24a1 UTSW 2 170485940 missense probably damaging 1.00
R7976:Cyp24a1 UTSW 2 170496516 critical splice donor site probably null
X0061:Cyp24a1 UTSW 2 170485990 missense probably benign 0.03
Predicted Primers
Posted On2014-04-24