Incidental Mutation 'R1601:Gas6'
ID176152
Institutional Source Beutler Lab
Gene Symbol Gas6
Ensembl Gene ENSMUSG00000031451
Gene Namegrowth arrest specific 6
Synonymsgrowth arrest-specific, Gas-6, GAS 6
MMRRC Submission 039638-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1601 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location13465374-13494490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 13465786 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 662 (T662N)
Ref Sequence ENSEMBL: ENSMUSP00000033828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033828] [ENSMUST00000167071] [ENSMUST00000167505] [ENSMUST00000210804]
Predicted Effect probably damaging
Transcript: ENSMUST00000033828
AA Change: T662N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033828
Gene: ENSMUSG00000031451
AA Change: T662N

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
GLA 26 90 6.66e-30 SMART
EGF 116 151 3.97e0 SMART
EGF_CA 153 193 3.1e-11 SMART
EGF_CA 194 234 1.91e-11 SMART
EGF_CA 235 275 1.25e-6 SMART
LamG 314 450 2.71e-24 SMART
LamG 502 647 1.27e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167071
SMART Domains Protein: ENSMUSP00000127421
Gene: ENSMUSG00000038457

DomainStartEndE-ValueType
Pfam:FAM70 1 68 8.2e-28 PFAM
Pfam:FAM70 66 307 1.8e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167505
SMART Domains Protein: ENSMUSP00000130504
Gene: ENSMUSG00000038457

DomainStartEndE-ValueType
Pfam:FAM70 6 328 6e-166 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209950
Predicted Effect probably benign
Transcript: ENSMUST00000210804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211356
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-carboxyglutamic acid (Gla)-containing protein thought to be involved in the stimulation of cell proliferation. This gene is frequently overexpressed in many cancers and has been implicated as an adverse prognostic marker. Elevated protein levels are additionally associated with a variety of disease states, including venous thromboembolic disease, systemic lupus erythematosus, chronic renal failure, and preeclampsia. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice are protected against arterial and venous thrombosis, and though platelet aggregation is impaired, spontaneous or excess trauma-induced bleeding is not observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4933416C03Rik T C 10: 116,113,616 S2G probably damaging Het
Adgra2 T C 8: 27,110,018 probably null Het
Adgrb2 T C 4: 129,992,837 S257P probably benign Het
Adgre1 A G 17: 57,441,353 K518E probably benign Het
Anxa7 A T 14: 20,464,615 Y64* probably null Het
Arhgef7 A G 8: 11,782,638 probably null Het
Cdc42bpa T A 1: 180,065,001 Y243* probably null Het
Cdk14 C T 5: 5,135,378 V176M probably damaging Het
Cnbd2 A G 2: 156,333,631 E54G probably damaging Het
Crx T C 7: 15,867,811 probably null Het
Cyp24a1 A G 2: 170,485,691 F511L possibly damaging Het
Ddx11 A G 17: 66,150,385 M810V probably damaging Het
Dock10 T C 1: 80,549,802 T1077A probably benign Het
Dopey1 G A 9: 86,536,250 D2011N probably damaging Het
Ehhadh T A 16: 21,766,408 H241L probably benign Het
Enah A T 1: 181,919,620 L523* probably null Het
Fabp3 T C 4: 130,308,848 L24P probably benign Het
Fat2 A G 11: 55,282,010 S2626P probably benign Het
Fbxo4 A G 15: 3,968,965 M337T possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hrh4 G A 18: 13,015,898 V106I possibly damaging Het
Ido2 G T 8: 24,576,189 H20Q possibly damaging Het
Ikbkap T A 4: 56,774,756 K740* probably null Het
Itga10 G T 3: 96,653,658 R613L possibly damaging Het
Itsn2 T C 12: 4,658,452 S836P probably benign Het
Kcng3 A T 17: 83,588,339 C233S probably damaging Het
Kdm3b A G 18: 34,808,731 Q625R probably damaging Het
Kidins220 A G 12: 25,005,088 S553G probably benign Het
Krt82 A T 15: 101,545,153 I266N probably damaging Het
Lama5 A T 2: 180,197,745 L736Q probably damaging Het
Lnx2 A G 5: 147,033,519 C138R probably damaging Het
Mcm5 T C 8: 75,119,354 C397R possibly damaging Het
Me1 A C 9: 86,678,012 Y52D probably damaging Het
Muc4 C A 16: 32,755,501 probably benign Het
Myo18b G T 5: 112,871,498 Q638K possibly damaging Het
Ncapd2 A G 6: 125,185,772 L170P probably damaging Het
Neb A T 2: 52,287,252 L1359* probably null Het
Nomo1 C A 7: 46,046,955 S299Y probably damaging Het
Olfr1359 C A 13: 21,703,226 T75K probably damaging Het
Olfr1509 A C 14: 52,450,442 T10P probably benign Het
Olfr322 A T 11: 58,666,077 R173W probably damaging Het
Olfr57 A T 10: 79,035,504 Y236F possibly damaging Het
Onecut1 A T 9: 74,862,691 H132L probably benign Het
Paqr3 A G 5: 97,111,389 Y19H probably benign Het
Prdx5 T C 19: 6,907,558 H140R possibly damaging Het
Prox1 T C 1: 190,161,006 D414G probably damaging Het
Ptprh T G 7: 4,552,638 E774A probably damaging Het
Rnpepl1 A T 1: 92,917,222 D412V possibly damaging Het
Sars2 C T 7: 28,748,971 T259M probably benign Het
Sbf2 T C 7: 110,340,076 probably null Het
Sbno2 C T 10: 80,060,492 R898H probably damaging Het
Smox C A 2: 131,520,174 T172N probably damaging Het
Tdrd9 C T 12: 112,023,253 R341* probably null Het
Thrap3 C G 4: 126,180,101 G284A probably damaging Het
Tmtc4 A G 14: 122,944,826 V271A probably benign Het
Trank1 A G 9: 111,373,477 T1637A probably damaging Het
Tspan5 T A 3: 138,896,835 I166N probably damaging Het
Vps13b T C 15: 35,642,436 V1398A probably benign Het
Xbp1 C T 11: 5,521,975 R34W probably damaging Het
Other mutations in Gas6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Gas6 APN 8 13476171 missense probably damaging 0.99
IGL01100:Gas6 APN 8 13475118 missense probably benign 0.27
IGL02014:Gas6 APN 8 13468359 missense possibly damaging 0.59
IGL02931:Gas6 APN 8 13477136 missense probably damaging 0.98
R0023:Gas6 UTSW 8 13470344 missense probably damaging 1.00
R0497:Gas6 UTSW 8 13470387 missense possibly damaging 0.86
R1126:Gas6 UTSW 8 13483700 missense probably benign 0.02
R1597:Gas6 UTSW 8 13493901 missense probably damaging 1.00
R1643:Gas6 UTSW 8 13465902 critical splice acceptor site probably null
R1914:Gas6 UTSW 8 13477152 missense probably benign
R1967:Gas6 UTSW 8 13470317 missense probably damaging 0.98
R2012:Gas6 UTSW 8 13468266 missense probably damaging 1.00
R4663:Gas6 UTSW 8 13470254 missense probably damaging 1.00
R4723:Gas6 UTSW 8 13466848 missense probably damaging 0.99
R4750:Gas6 UTSW 8 13476227 missense probably benign 0.29
R4869:Gas6 UTSW 8 13475086 missense possibly damaging 0.55
R5558:Gas6 UTSW 8 13466764 missense probably null 0.03
R5706:Gas6 UTSW 8 13477098 missense probably damaging 0.98
R5791:Gas6 UTSW 8 13470217 critical splice donor site probably null
R6767:Gas6 UTSW 8 13465784 missense probably damaging 0.98
R6825:Gas6 UTSW 8 13483674 missense probably benign 0.00
R7374:Gas6 UTSW 8 13474802 missense probably damaging 0.99
R7419:Gas6 UTSW 8 13471456 missense probably benign 0.19
R7588:Gas6 UTSW 8 13466711 missense probably benign 0.03
R7810:Gas6 UTSW 8 13466809 missense probably damaging 1.00
X0063:Gas6 UTSW 8 13471538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACACCCGTCCCATTATGTACAG -3'
(R):5'- CAGAATCAAAGGCATGGGGACTCAC -3'

Sequencing Primer
(F):5'- ACCCGTCCCATTATGTACAGATATG -3'
(R):5'- ATGCCGATGATGTCTTATGCC -3'
Posted On2014-04-24