Incidental Mutation 'R1601:Ido2'
ID176153
Institutional Source Beutler Lab
Gene Symbol Ido2
Ensembl Gene ENSMUSG00000031549
Gene Nameindoleamine 2,3-dioxygenase 2
SynonymsIndol1, C230043N17Rik, Ido2
MMRRC Submission 039638-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1601 (G1)
Quality Score137
Status Not validated
Chromosome8
Chromosomal Location24531892-24576333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24576189 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 20 (H20Q)
Ref Sequence ENSEMBL: ENSMUSP00000113979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121992]
Predicted Effect possibly damaging
Transcript: ENSMUST00000121992
AA Change: H20Q

PolyPhen 2 Score 0.573 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113979
Gene: ENSMUSG00000031549
AA Change: H20Q

DomainStartEndE-ValueType
Pfam:IDO 15 399 1.4e-124 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Along with the enzymes encoded by the INDO (MIM 147435) and TDO2 (MIM 191070) genes, the enzyme encoded by the INDOL1 gene metabolizes tryptophan in the kynurenine pathway (Ball et al., 2007 [PubMed 17499941]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell function and decreased susceptibility to type IV hypersensitivity reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4933416C03Rik T C 10: 116,113,616 S2G probably damaging Het
Adgra2 T C 8: 27,110,018 probably null Het
Adgrb2 T C 4: 129,992,837 S257P probably benign Het
Adgre1 A G 17: 57,441,353 K518E probably benign Het
Anxa7 A T 14: 20,464,615 Y64* probably null Het
Arhgef7 A G 8: 11,782,638 probably null Het
Cdc42bpa T A 1: 180,065,001 Y243* probably null Het
Cdk14 C T 5: 5,135,378 V176M probably damaging Het
Cnbd2 A G 2: 156,333,631 E54G probably damaging Het
Crx T C 7: 15,867,811 probably null Het
Cyp24a1 A G 2: 170,485,691 F511L possibly damaging Het
Ddx11 A G 17: 66,150,385 M810V probably damaging Het
Dock10 T C 1: 80,549,802 T1077A probably benign Het
Dopey1 G A 9: 86,536,250 D2011N probably damaging Het
Ehhadh T A 16: 21,766,408 H241L probably benign Het
Enah A T 1: 181,919,620 L523* probably null Het
Fabp3 T C 4: 130,308,848 L24P probably benign Het
Fat2 A G 11: 55,282,010 S2626P probably benign Het
Fbxo4 A G 15: 3,968,965 M337T possibly damaging Het
Gas6 G T 8: 13,465,786 T662N probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hrh4 G A 18: 13,015,898 V106I possibly damaging Het
Ikbkap T A 4: 56,774,756 K740* probably null Het
Itga10 G T 3: 96,653,658 R613L possibly damaging Het
Itsn2 T C 12: 4,658,452 S836P probably benign Het
Kcng3 A T 17: 83,588,339 C233S probably damaging Het
Kdm3b A G 18: 34,808,731 Q625R probably damaging Het
Kidins220 A G 12: 25,005,088 S553G probably benign Het
Krt82 A T 15: 101,545,153 I266N probably damaging Het
Lama5 A T 2: 180,197,745 L736Q probably damaging Het
Lnx2 A G 5: 147,033,519 C138R probably damaging Het
Mcm5 T C 8: 75,119,354 C397R possibly damaging Het
Me1 A C 9: 86,678,012 Y52D probably damaging Het
Muc4 C A 16: 32,755,501 probably benign Het
Myo18b G T 5: 112,871,498 Q638K possibly damaging Het
Ncapd2 A G 6: 125,185,772 L170P probably damaging Het
Neb A T 2: 52,287,252 L1359* probably null Het
Nomo1 C A 7: 46,046,955 S299Y probably damaging Het
Olfr1359 C A 13: 21,703,226 T75K probably damaging Het
Olfr1509 A C 14: 52,450,442 T10P probably benign Het
Olfr322 A T 11: 58,666,077 R173W probably damaging Het
Olfr57 A T 10: 79,035,504 Y236F possibly damaging Het
Onecut1 A T 9: 74,862,691 H132L probably benign Het
Paqr3 A G 5: 97,111,389 Y19H probably benign Het
Prdx5 T C 19: 6,907,558 H140R possibly damaging Het
Prox1 T C 1: 190,161,006 D414G probably damaging Het
Ptprh T G 7: 4,552,638 E774A probably damaging Het
Rnpepl1 A T 1: 92,917,222 D412V possibly damaging Het
Sars2 C T 7: 28,748,971 T259M probably benign Het
Sbf2 T C 7: 110,340,076 probably null Het
Sbno2 C T 10: 80,060,492 R898H probably damaging Het
Smox C A 2: 131,520,174 T172N probably damaging Het
Tdrd9 C T 12: 112,023,253 R341* probably null Het
Thrap3 C G 4: 126,180,101 G284A probably damaging Het
Tmtc4 A G 14: 122,944,826 V271A probably benign Het
Trank1 A G 9: 111,373,477 T1637A probably damaging Het
Tspan5 T A 3: 138,896,835 I166N probably damaging Het
Vps13b T C 15: 35,642,436 V1398A probably benign Het
Xbp1 C T 11: 5,521,975 R34W probably damaging Het
Other mutations in Ido2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0413:Ido2 UTSW 8 24558143 splice site probably null
R1103:Ido2 UTSW 8 24576223 missense probably benign 0.08
R1868:Ido2 UTSW 8 24553760 missense possibly damaging 0.90
R2158:Ido2 UTSW 8 24540636 missense probably damaging 1.00
R2266:Ido2 UTSW 8 24535252 missense probably damaging 1.00
R2267:Ido2 UTSW 8 24535252 missense probably damaging 1.00
R2268:Ido2 UTSW 8 24535252 missense probably damaging 1.00
R2484:Ido2 UTSW 8 24533815 missense probably damaging 1.00
R3151:Ido2 UTSW 8 24533760 missense possibly damaging 0.61
R3735:Ido2 UTSW 8 24535193 missense probably damaging 0.98
R3820:Ido2 UTSW 8 24533755 missense probably benign 0.00
R3821:Ido2 UTSW 8 24533755 missense probably benign 0.00
R3822:Ido2 UTSW 8 24533755 missense probably benign 0.00
R4520:Ido2 UTSW 8 24576178 missense probably damaging 0.99
R4824:Ido2 UTSW 8 24533859 missense probably benign 0.12
R4949:Ido2 UTSW 8 24533954 critical splice acceptor site probably null
R5235:Ido2 UTSW 8 24547186 missense probably damaging 0.99
R5580:Ido2 UTSW 8 24550866 missense possibly damaging 0.67
R5961:Ido2 UTSW 8 24533770 missense probably damaging 1.00
R6433:Ido2 UTSW 8 24533923 missense probably damaging 1.00
R7085:Ido2 UTSW 8 24558196 missense probably benign 0.09
R7186:Ido2 UTSW 8 24550810 synonymous probably null
R7248:Ido2 UTSW 8 24540641 nonsense probably null
R7248:Ido2 UTSW 8 24548823 missense probably damaging 0.97
R7287:Ido2 UTSW 8 24535138 splice site probably null
R7788:Ido2 UTSW 8 24547226 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCGGGACTCACAGGACTGTATTC -3'
(R):5'- GATCTGCACAGCCATAGCTGAGAG -3'

Sequencing Primer
(F):5'- CACAGGACTGTATTCCCACTC -3'
(R):5'- GAATAAATTTGCGGCCATCCTGG -3'
Posted On2014-04-24