Incidental Mutation 'R1601:Mcm5'
ID176155
Institutional Source Beutler Lab
Gene Symbol Mcm5
Ensembl Gene ENSMUSG00000005410
Gene Nameminichromosome maintenance complex component 5
SynonymsCdc46, mCD46, Mcmd5
MMRRC Submission 039638-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1601 (G1)
Quality Score195
Status Not validated
Chromosome8
Chromosomal Location75109569-75128439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75119354 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 397 (C397R)
Ref Sequence ENSEMBL: ENSMUSP00000148525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164309] [ENSMUST00000212426] [ENSMUST00000212811]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164309
AA Change: C397R

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126135
Gene: ENSMUSG00000005410
AA Change: C397R

DomainStartEndE-ValueType
MCM 133 649 N/A SMART
Blast:MCM 693 734 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211912
Predicted Effect possibly damaging
Transcript: ENSMUST00000212426
AA Change: C397R

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212648
Predicted Effect possibly damaging
Transcript: ENSMUST00000212811
AA Change: C397R

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the oligameric minichromosome maintenance protein complex. During DNA replication, the complex loads onto chromatin in early G1 and is converted into an active replicative helicase during S phase. It functions to limit DNA synthesis to once per cell cycle. During embryogenesis, the encoded protein is negatively regulated through expression of paired box protein Pax 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4933416C03Rik T C 10: 116,113,616 S2G probably damaging Het
Adgra2 T C 8: 27,110,018 probably null Het
Adgrb2 T C 4: 129,992,837 S257P probably benign Het
Adgre1 A G 17: 57,441,353 K518E probably benign Het
Anxa7 A T 14: 20,464,615 Y64* probably null Het
Arhgef7 A G 8: 11,782,638 probably null Het
Cdc42bpa T A 1: 180,065,001 Y243* probably null Het
Cdk14 C T 5: 5,135,378 V176M probably damaging Het
Cnbd2 A G 2: 156,333,631 E54G probably damaging Het
Crx T C 7: 15,867,811 probably null Het
Cyp24a1 A G 2: 170,485,691 F511L possibly damaging Het
Ddx11 A G 17: 66,150,385 M810V probably damaging Het
Dock10 T C 1: 80,549,802 T1077A probably benign Het
Dopey1 G A 9: 86,536,250 D2011N probably damaging Het
Ehhadh T A 16: 21,766,408 H241L probably benign Het
Enah A T 1: 181,919,620 L523* probably null Het
Fabp3 T C 4: 130,308,848 L24P probably benign Het
Fat2 A G 11: 55,282,010 S2626P probably benign Het
Fbxo4 A G 15: 3,968,965 M337T possibly damaging Het
Gas6 G T 8: 13,465,786 T662N probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hrh4 G A 18: 13,015,898 V106I possibly damaging Het
Ido2 G T 8: 24,576,189 H20Q possibly damaging Het
Ikbkap T A 4: 56,774,756 K740* probably null Het
Itga10 G T 3: 96,653,658 R613L possibly damaging Het
Itsn2 T C 12: 4,658,452 S836P probably benign Het
Kcng3 A T 17: 83,588,339 C233S probably damaging Het
Kdm3b A G 18: 34,808,731 Q625R probably damaging Het
Kidins220 A G 12: 25,005,088 S553G probably benign Het
Krt82 A T 15: 101,545,153 I266N probably damaging Het
Lama5 A T 2: 180,197,745 L736Q probably damaging Het
Lnx2 A G 5: 147,033,519 C138R probably damaging Het
Me1 A C 9: 86,678,012 Y52D probably damaging Het
Muc4 C A 16: 32,755,501 probably benign Het
Myo18b G T 5: 112,871,498 Q638K possibly damaging Het
Ncapd2 A G 6: 125,185,772 L170P probably damaging Het
Neb A T 2: 52,287,252 L1359* probably null Het
Nomo1 C A 7: 46,046,955 S299Y probably damaging Het
Olfr1359 C A 13: 21,703,226 T75K probably damaging Het
Olfr1509 A C 14: 52,450,442 T10P probably benign Het
Olfr322 A T 11: 58,666,077 R173W probably damaging Het
Olfr57 A T 10: 79,035,504 Y236F possibly damaging Het
Onecut1 A T 9: 74,862,691 H132L probably benign Het
Paqr3 A G 5: 97,111,389 Y19H probably benign Het
Prdx5 T C 19: 6,907,558 H140R possibly damaging Het
Prox1 T C 1: 190,161,006 D414G probably damaging Het
Ptprh T G 7: 4,552,638 E774A probably damaging Het
Rnpepl1 A T 1: 92,917,222 D412V possibly damaging Het
Sars2 C T 7: 28,748,971 T259M probably benign Het
Sbf2 T C 7: 110,340,076 probably null Het
Sbno2 C T 10: 80,060,492 R898H probably damaging Het
Smox C A 2: 131,520,174 T172N probably damaging Het
Tdrd9 C T 12: 112,023,253 R341* probably null Het
Thrap3 C G 4: 126,180,101 G284A probably damaging Het
Tmtc4 A G 14: 122,944,826 V271A probably benign Het
Trank1 A G 9: 111,373,477 T1637A probably damaging Het
Tspan5 T A 3: 138,896,835 I166N probably damaging Het
Vps13b T C 15: 35,642,436 V1398A probably benign Het
Xbp1 C T 11: 5,521,975 R34W probably damaging Het
Other mutations in Mcm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mcm5 APN 8 75124945 critical splice donor site probably null
IGL00954:Mcm5 APN 8 75110112 missense possibly damaging 0.78
IGL02534:Mcm5 APN 8 75114233 missense probably damaging 1.00
IGL03074:Mcm5 APN 8 75119301 missense possibly damaging 0.94
IGL03176:Mcm5 APN 8 75109853 missense possibly damaging 0.95
IGL03240:Mcm5 APN 8 75115902 missense probably damaging 1.00
PIT4142001:Mcm5 UTSW 8 75127236 missense probably benign
R0133:Mcm5 UTSW 8 75120911 missense probably damaging 1.00
R0138:Mcm5 UTSW 8 75120880 missense probably damaging 1.00
R0226:Mcm5 UTSW 8 75126252 missense possibly damaging 0.90
R0733:Mcm5 UTSW 8 75127248 missense probably benign 0.08
R1217:Mcm5 UTSW 8 75126291 missense probably benign 0.01
R1834:Mcm5 UTSW 8 75119273 missense possibly damaging 0.64
R1958:Mcm5 UTSW 8 75121629 missense probably benign 0.34
R3410:Mcm5 UTSW 8 75121644 missense possibly damaging 0.88
R4133:Mcm5 UTSW 8 75115854 missense probably damaging 1.00
R4441:Mcm5 UTSW 8 75112544 missense probably benign 0.39
R5395:Mcm5 UTSW 8 75123026 missense probably benign
R5710:Mcm5 UTSW 8 75120910 missense probably damaging 1.00
R5714:Mcm5 UTSW 8 75120910 missense probably damaging 1.00
R6075:Mcm5 UTSW 8 75114197 missense probably damaging 1.00
R6093:Mcm5 UTSW 8 75109746 missense probably benign 0.06
R6477:Mcm5 UTSW 8 75112602 missense probably benign 0.36
R6848:Mcm5 UTSW 8 75127290 missense possibly damaging 0.88
R7098:Mcm5 UTSW 8 75120901 missense probably damaging 1.00
R7208:Mcm5 UTSW 8 75121716 critical splice donor site probably null
R7278:Mcm5 UTSW 8 75124859 missense probably benign 0.40
R7552:Mcm5 UTSW 8 75121592 missense probably damaging 0.99
R7701:Mcm5 UTSW 8 75123923 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCCACATAAAGCCAAGAGTGCTG -3'
(R):5'- AGGCTACCTCTTCCAAGTCCACTG -3'

Sequencing Primer
(F):5'- GCCAAGAGTGCTGATACATAAC -3'
(R):5'- ctgagaagcaaagcaagcc -3'
Posted On2014-04-24