Incidental Mutation 'R1601:Olfr322'
ID176166
Institutional Source Beutler Lab
Gene Symbol Olfr322
Ensembl Gene ENSMUSG00000063549
Gene Nameolfactory receptor 322
SynonymsGA_x6K02T2NKPP-754816-754257, OTTMUSG00000005755, Olfr216, Olfr322-ps1, Olfr179, GA_x6K02SYUPNB-557-3, MOR256-64, GA_x6K02SYUNE5-2-727
MMRRC Submission 039638-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1601 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58658782-58669528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58666077 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 173 (R173W)
Ref Sequence ENSEMBL: ENSMUSP00000149062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072030] [ENSMUST00000213232] [ENSMUST00000213793] [ENSMUST00000214392] [ENSMUST00000214400] [ENSMUST00000216442] [ENSMUST00000217399]
Predicted Effect probably damaging
Transcript: ENSMUST00000072030
AA Change: R173W

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071913
Gene: ENSMUSG00000063549
AA Change: R173W

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 25 305 2.7e-6 PFAM
Pfam:7tm_4 31 308 3.5e-48 PFAM
Pfam:7tm_1 41 290 3.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157597
Predicted Effect probably damaging
Transcript: ENSMUST00000213232
AA Change: R173W

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000213793
AA Change: R173W

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000214392
AA Change: R173W

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000214400
AA Change: R173W

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000216442
AA Change: R173W

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000217399
AA Change: R173W

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4933416C03Rik T C 10: 116,113,616 S2G probably damaging Het
Adgra2 T C 8: 27,110,018 probably null Het
Adgrb2 T C 4: 129,992,837 S257P probably benign Het
Adgre1 A G 17: 57,441,353 K518E probably benign Het
Anxa7 A T 14: 20,464,615 Y64* probably null Het
Arhgef7 A G 8: 11,782,638 probably null Het
Cdc42bpa T A 1: 180,065,001 Y243* probably null Het
Cdk14 C T 5: 5,135,378 V176M probably damaging Het
Cnbd2 A G 2: 156,333,631 E54G probably damaging Het
Crx T C 7: 15,867,811 probably null Het
Cyp24a1 A G 2: 170,485,691 F511L possibly damaging Het
Ddx11 A G 17: 66,150,385 M810V probably damaging Het
Dock10 T C 1: 80,549,802 T1077A probably benign Het
Dopey1 G A 9: 86,536,250 D2011N probably damaging Het
Ehhadh T A 16: 21,766,408 H241L probably benign Het
Enah A T 1: 181,919,620 L523* probably null Het
Fabp3 T C 4: 130,308,848 L24P probably benign Het
Fat2 A G 11: 55,282,010 S2626P probably benign Het
Fbxo4 A G 15: 3,968,965 M337T possibly damaging Het
Gas6 G T 8: 13,465,786 T662N probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hrh4 G A 18: 13,015,898 V106I possibly damaging Het
Ido2 G T 8: 24,576,189 H20Q possibly damaging Het
Ikbkap T A 4: 56,774,756 K740* probably null Het
Itga10 G T 3: 96,653,658 R613L possibly damaging Het
Itsn2 T C 12: 4,658,452 S836P probably benign Het
Kcng3 A T 17: 83,588,339 C233S probably damaging Het
Kdm3b A G 18: 34,808,731 Q625R probably damaging Het
Kidins220 A G 12: 25,005,088 S553G probably benign Het
Krt82 A T 15: 101,545,153 I266N probably damaging Het
Lama5 A T 2: 180,197,745 L736Q probably damaging Het
Lnx2 A G 5: 147,033,519 C138R probably damaging Het
Mcm5 T C 8: 75,119,354 C397R possibly damaging Het
Me1 A C 9: 86,678,012 Y52D probably damaging Het
Muc4 C A 16: 32,755,501 probably benign Het
Myo18b G T 5: 112,871,498 Q638K possibly damaging Het
Ncapd2 A G 6: 125,185,772 L170P probably damaging Het
Neb A T 2: 52,287,252 L1359* probably null Het
Nomo1 C A 7: 46,046,955 S299Y probably damaging Het
Olfr1359 C A 13: 21,703,226 T75K probably damaging Het
Olfr1509 A C 14: 52,450,442 T10P probably benign Het
Olfr57 A T 10: 79,035,504 Y236F possibly damaging Het
Onecut1 A T 9: 74,862,691 H132L probably benign Het
Paqr3 A G 5: 97,111,389 Y19H probably benign Het
Prdx5 T C 19: 6,907,558 H140R possibly damaging Het
Prox1 T C 1: 190,161,006 D414G probably damaging Het
Ptprh T G 7: 4,552,638 E774A probably damaging Het
Rnpepl1 A T 1: 92,917,222 D412V possibly damaging Het
Sars2 C T 7: 28,748,971 T259M probably benign Het
Sbf2 T C 7: 110,340,076 probably null Het
Sbno2 C T 10: 80,060,492 R898H probably damaging Het
Smox C A 2: 131,520,174 T172N probably damaging Het
Tdrd9 C T 12: 112,023,253 R341* probably null Het
Thrap3 C G 4: 126,180,101 G284A probably damaging Het
Tmtc4 A G 14: 122,944,826 V271A probably benign Het
Trank1 A G 9: 111,373,477 T1637A probably damaging Het
Tspan5 T A 3: 138,896,835 I166N probably damaging Het
Vps13b T C 15: 35,642,436 V1398A probably benign Het
Xbp1 C T 11: 5,521,975 R34W probably damaging Het
Other mutations in Olfr322
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Olfr322 APN 11 58665865 missense probably benign 0.05
IGL02514:Olfr322 APN 11 58665643 missense probably damaging 1.00
IGL02823:Olfr322 APN 11 58665967 missense possibly damaging 0.95
R0449:Olfr322 UTSW 11 58665963 missense probably benign 0.02
R0600:Olfr322 UTSW 11 58666160 missense probably damaging 1.00
R0865:Olfr322 UTSW 11 58665652 missense possibly damaging 0.84
R2062:Olfr322 UTSW 11 58665982 missense probably damaging 1.00
R5642:Olfr322 UTSW 11 58666399 missense possibly damaging 0.55
R6232:Olfr322 UTSW 11 58665931 missense possibly damaging 0.95
R7383:Olfr322 UTSW 11 58666185 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGACCTCAGCTTCACCAGTAGCTC -3'
(R):5'- ACGTGTTGAATGCCTTCTGCCG -3'

Sequencing Primer
(F):5'- GCTACTCTATAACCTCAGCGGG -3'
(R):5'- AACACGATGCCTATTGCCAG -3'
Posted On2014-04-24