Mutagenetix > Incidental Mutations

Incidental Mutation 'R1601:Krt82'

176176

Institutional Source

Beutler Lab

Gene Symbol

Krt82

Ensembl Gene

ENSMUSG00000049548

Gene Name

keratin 82

Synonyms

Krt2-20

MMRRC Submission

039638-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R1601 (G1)

Quality Score

138

Status

Not validated

Chromosome

Chromosomal Location

101541214-101550667 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101545153 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 266 (I266N)

Ref Sequence

ENSEMBL: ENSMUSP00000023713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023713]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023713
AA Change: I266N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023713
Gene: ENSMUSG00000049548
AA Change: I266N

Domain	Start	End	E-Value	Type
low complexity region	38	57	N/A	INTRINSIC
Pfam:Keratin_2_head	61	114	6.1e-13	PFAM
Filament	117	428	1.32e-153	SMART

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.1%
20x: 88.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this keratin appears to be a hair cuticle-specific keratin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032F04Rik	G	A	3: 68,870,213	S169N	probably benign	Het
4933416C03Rik	T	C	10: 116,113,616	S2G	probably damaging	Het
Adgra2	T	C	8: 27,110,018		probably null	Het
Adgrb2	T	C	4: 129,992,837	S257P	probably benign	Het
Adgre1	A	G	17: 57,441,353	K518E	probably benign	Het
Anxa7	A	T	14: 20,464,615	Y64*	probably null	Het
Arhgef7	A	G	8: 11,782,638		probably null	Het
Cdc42bpa	T	A	1: 180,065,001	Y243*	probably null	Het
Cdk14	C	T	5: 5,135,378	V176M	probably damaging	Het
Cnbd2	A	G	2: 156,333,631	E54G	probably damaging	Het
Crx	T	C	7: 15,867,811		probably null	Het
Cyp24a1	A	G	2: 170,485,691	F511L	possibly damaging	Het
Ddx11	A	G	17: 66,150,385	M810V	probably damaging	Het
Dock10	T	C	1: 80,549,802	T1077A	probably benign	Het
Dopey1	G	A	9: 86,536,250	D2011N	probably damaging	Het
Ehhadh	T	A	16: 21,766,408	H241L	probably benign	Het
Enah	A	T	1: 181,919,620	L523*	probably null	Het
Fabp3	T	C	4: 130,308,848	L24P	probably benign	Het
Fat2	A	G	11: 55,282,010	S2626P	probably benign	Het
Fbxo4	A	G	15: 3,968,965	M337T	possibly damaging	Het
Gas6	G	T	8: 13,465,786	T662N	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Hrh4	G	A	18: 13,015,898	V106I	possibly damaging	Het
Ido2	G	T	8: 24,576,189	H20Q	possibly damaging	Het
Ikbkap	T	A	4: 56,774,756	K740*	probably null	Het
Itga10	G	T	3: 96,653,658	R613L	possibly damaging	Het
Itsn2	T	C	12: 4,658,452	S836P	probably benign	Het
Kcng3	A	T	17: 83,588,339	C233S	probably damaging	Het
Kdm3b	A	G	18: 34,808,731	Q625R	probably damaging	Het
Kidins220	A	G	12: 25,005,088	S553G	probably benign	Het
Lama5	A	T	2: 180,197,745	L736Q	probably damaging	Het
Lnx2	A	G	5: 147,033,519	C138R	probably damaging	Het
Mcm5	T	C	8: 75,119,354	C397R	possibly damaging	Het
Me1	A	C	9: 86,678,012	Y52D	probably damaging	Het
Muc4	C	A	16: 32,755,501		probably benign	Het
Myo18b	G	T	5: 112,871,498	Q638K	possibly damaging	Het
Ncapd2	A	G	6: 125,185,772	L170P	probably damaging	Het
Neb	A	T	2: 52,287,252	L1359*	probably null	Het
Nomo1	C	A	7: 46,046,955	S299Y	probably damaging	Het
Olfr1359	C	A	13: 21,703,226	T75K	probably damaging	Het
Olfr1509	A	C	14: 52,450,442	T10P	probably benign	Het
Olfr322	A	T	11: 58,666,077	R173W	probably damaging	Het
Olfr57	A	T	10: 79,035,504	Y236F	possibly damaging	Het
Onecut1	A	T	9: 74,862,691	H132L	probably benign	Het
Paqr3	A	G	5: 97,111,389	Y19H	probably benign	Het
Prdx5	T	C	19: 6,907,558	H140R	possibly damaging	Het
Prox1	T	C	1: 190,161,006	D414G	probably damaging	Het
Ptprh	T	G	7: 4,552,638	E774A	probably damaging	Het
Rnpepl1	A	T	1: 92,917,222	D412V	possibly damaging	Het
Sars2	C	T	7: 28,748,971	T259M	probably benign	Het
Sbf2	T	C	7: 110,340,076		probably null	Het
Sbno2	C	T	10: 80,060,492	R898H	probably damaging	Het
Smox	C	A	2: 131,520,174	T172N	probably damaging	Het
Tdrd9	C	T	12: 112,023,253	R341*	probably null	Het
Thrap3	C	G	4: 126,180,101	G284A	probably damaging	Het
Tmtc4	A	G	14: 122,944,826	V271A	probably benign	Het
Trank1	A	G	9: 111,373,477	T1637A	probably damaging	Het
Tspan5	T	A	3: 138,896,835	I166N	probably damaging	Het
Vps13b	T	C	15: 35,642,436	V1398A	probably benign	Het
Xbp1	C	T	11: 5,521,975	R34W	probably damaging	Het

Other mutations in Krt82

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Krt82	APN	15	101543378	missense	probably damaging	0.97
IGL01112:Krt82	APN	15	101545523	missense	probably damaging	1.00
IGL01820:Krt82	APN	15	101543452	splice site	probably benign
IGL02529:Krt82	APN	15	101550396	nonsense	probably null
IGL02894:Krt82	APN	15	101542720	missense	probably damaging	1.00
IGL02974:Krt82	APN	15	101550585	nonsense	probably null
IGL03263:Krt82	APN	15	101541872	missense	probably benign	0.00
R0268:Krt82	UTSW	15	101541713	missense	probably benign	0.02
R0385:Krt82	UTSW	15	101545593	missense	probably damaging	1.00
R0542:Krt82	UTSW	15	101545600	splice site	probably benign
R1073:Krt82	UTSW	15	101550254	missense	probably damaging	1.00
R1795:Krt82	UTSW	15	101543384	missense	possibly damaging	0.90
R1944:Krt82	UTSW	15	101548535	missense	probably damaging	1.00
R1974:Krt82	UTSW	15	101545162	missense	probably benign	0.00
R2049:Krt82	UTSW	15	101545156	missense	probably damaging	0.96
R2140:Krt82	UTSW	15	101545156	missense	probably damaging	0.96
R2851:Krt82	UTSW	15	101548435	missense	probably damaging	1.00
R2852:Krt82	UTSW	15	101548435	missense	probably damaging	1.00
R2853:Krt82	UTSW	15	101548435	missense	probably damaging	1.00
R3815:Krt82	UTSW	15	101550600	missense	probably damaging	1.00
R4324:Krt82	UTSW	15	101541747	missense	probably benign	0.00
R4798:Krt82	UTSW	15	101550488	missense	probably benign	0.01
R4980:Krt82	UTSW	15	101545099	missense	possibly damaging	0.85
R5212:Krt82	UTSW	15	101545049	missense	probably damaging	1.00
R5260:Krt82	UTSW	15	101548388	missense	possibly damaging	0.88
R5821:Krt82	UTSW	15	101548385	nonsense	probably null
R6009:Krt82	UTSW	15	101545105	missense	probably benign	0.00
R6955:Krt82	UTSW	15	101542849	missense	probably damaging	1.00
R7194:Krt82	UTSW	15	101542756	missense	probably damaging	1.00
R7307:Krt82	UTSW	15	101542907	missense	probably damaging	0.97
R7420:Krt82	UTSW	15	101545587	missense	probably damaging	0.96
R7837:Krt82	UTSW	15	101548357	missense	possibly damaging	0.86
R7920:Krt82	UTSW	15	101548357	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- AGAGAGCAATGGGACCCTGTCTTC -3'
(R):5'- TCTGGGTGATCTGTCAGGCAAATTC -3'

Sequencing Primer
(F):5'- GGGACCCTGTCTTCTGCTTC -3'
(R):5'- TAGTGGGACATCTCATGCAC -3'

Posted On

2014-04-24