Incidental Mutation 'R1601:Ehhadh'
ID176177
Institutional Source Beutler Lab
Gene Symbol Ehhadh
Ensembl Gene ENSMUSG00000022853
Gene Nameenoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase
SynonymsMFP, L-PBE, MFP1, L-bifunctional enzyme, 1300002P22Rik, HD
MMRRC Submission 039638-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1601 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location21761287-21787807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21766408 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 241 (H241L)
Ref Sequence ENSEMBL: ENSMUSP00000023559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023559]
Predicted Effect probably benign
Transcript: ENSMUST00000023559
AA Change: H241L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023559
Gene: ENSMUSG00000022853
AA Change: H241L

DomainStartEndE-ValueType
Pfam:ECH_1 6 203 2.4e-41 PFAM
Pfam:ECH_2 11 254 3.2e-26 PFAM
Pfam:3HCDH_N 297 471 1e-55 PFAM
Pfam:3HCDH 473 577 2.7e-29 PFAM
Pfam:3HCDH 614 710 5.3e-10 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme and is one of the four enzymes of the peroxisomal beta-oxidation pathway. The N-terminal region of the encoded protein contains enoyl-CoA hydratase activity while the C-terminal region contains 3-hydroxyacyl-CoA dehydrogenase activity. Defects in this gene are a cause of peroxisomal disorders such as Zellweger syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruption of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4933416C03Rik T C 10: 116,113,616 S2G probably damaging Het
Adgra2 T C 8: 27,110,018 probably null Het
Adgrb2 T C 4: 129,992,837 S257P probably benign Het
Adgre1 A G 17: 57,441,353 K518E probably benign Het
Anxa7 A T 14: 20,464,615 Y64* probably null Het
Arhgef7 A G 8: 11,782,638 probably null Het
Cdc42bpa T A 1: 180,065,001 Y243* probably null Het
Cdk14 C T 5: 5,135,378 V176M probably damaging Het
Cnbd2 A G 2: 156,333,631 E54G probably damaging Het
Crx T C 7: 15,867,811 probably null Het
Cyp24a1 A G 2: 170,485,691 F511L possibly damaging Het
Ddx11 A G 17: 66,150,385 M810V probably damaging Het
Dock10 T C 1: 80,549,802 T1077A probably benign Het
Dopey1 G A 9: 86,536,250 D2011N probably damaging Het
Enah A T 1: 181,919,620 L523* probably null Het
Fabp3 T C 4: 130,308,848 L24P probably benign Het
Fat2 A G 11: 55,282,010 S2626P probably benign Het
Fbxo4 A G 15: 3,968,965 M337T possibly damaging Het
Gas6 G T 8: 13,465,786 T662N probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hrh4 G A 18: 13,015,898 V106I possibly damaging Het
Ido2 G T 8: 24,576,189 H20Q possibly damaging Het
Ikbkap T A 4: 56,774,756 K740* probably null Het
Itga10 G T 3: 96,653,658 R613L possibly damaging Het
Itsn2 T C 12: 4,658,452 S836P probably benign Het
Kcng3 A T 17: 83,588,339 C233S probably damaging Het
Kdm3b A G 18: 34,808,731 Q625R probably damaging Het
Kidins220 A G 12: 25,005,088 S553G probably benign Het
Krt82 A T 15: 101,545,153 I266N probably damaging Het
Lama5 A T 2: 180,197,745 L736Q probably damaging Het
Lnx2 A G 5: 147,033,519 C138R probably damaging Het
Mcm5 T C 8: 75,119,354 C397R possibly damaging Het
Me1 A C 9: 86,678,012 Y52D probably damaging Het
Muc4 C A 16: 32,755,501 probably benign Het
Myo18b G T 5: 112,871,498 Q638K possibly damaging Het
Ncapd2 A G 6: 125,185,772 L170P probably damaging Het
Neb A T 2: 52,287,252 L1359* probably null Het
Nomo1 C A 7: 46,046,955 S299Y probably damaging Het
Olfr1359 C A 13: 21,703,226 T75K probably damaging Het
Olfr1509 A C 14: 52,450,442 T10P probably benign Het
Olfr322 A T 11: 58,666,077 R173W probably damaging Het
Olfr57 A T 10: 79,035,504 Y236F possibly damaging Het
Onecut1 A T 9: 74,862,691 H132L probably benign Het
Paqr3 A G 5: 97,111,389 Y19H probably benign Het
Prdx5 T C 19: 6,907,558 H140R possibly damaging Het
Prox1 T C 1: 190,161,006 D414G probably damaging Het
Ptprh T G 7: 4,552,638 E774A probably damaging Het
Rnpepl1 A T 1: 92,917,222 D412V possibly damaging Het
Sars2 C T 7: 28,748,971 T259M probably benign Het
Sbf2 T C 7: 110,340,076 probably null Het
Sbno2 C T 10: 80,060,492 R898H probably damaging Het
Smox C A 2: 131,520,174 T172N probably damaging Het
Tdrd9 C T 12: 112,023,253 R341* probably null Het
Thrap3 C G 4: 126,180,101 G284A probably damaging Het
Tmtc4 A G 14: 122,944,826 V271A probably benign Het
Trank1 A G 9: 111,373,477 T1637A probably damaging Het
Tspan5 T A 3: 138,896,835 I166N probably damaging Het
Vps13b T C 15: 35,642,436 V1398A probably benign Het
Xbp1 C T 11: 5,521,975 R34W probably damaging Het
Other mutations in Ehhadh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Ehhadh APN 16 21762629 missense possibly damaging 0.46
IGL02351:Ehhadh APN 16 21762870 missense probably damaging 1.00
IGL02358:Ehhadh APN 16 21762870 missense probably damaging 1.00
IGL02946:Ehhadh APN 16 21762922 missense probably damaging 1.00
IGL03028:Ehhadh APN 16 21762394 missense probably damaging 1.00
IGL03274:Ehhadh APN 16 21763340 splice site probably benign
IGL03097:Ehhadh UTSW 16 21762770 missense probably benign
R0201:Ehhadh UTSW 16 21773493 critical splice donor site probably null
R0846:Ehhadh UTSW 16 21773497 nonsense probably null
R1194:Ehhadh UTSW 16 21762091 missense probably benign 0.10
R1739:Ehhadh UTSW 16 21762253 missense probably benign
R1829:Ehhadh UTSW 16 21762178 missense probably damaging 0.99
R4073:Ehhadh UTSW 16 21766507 missense probably benign 0.00
R4120:Ehhadh UTSW 16 21763184 missense probably benign
R4239:Ehhadh UTSW 16 21762688 missense probably damaging 1.00
R4303:Ehhadh UTSW 16 21762852 missense probably damaging 1.00
R4727:Ehhadh UTSW 16 21762431 missense probably benign 0.11
R4838:Ehhadh UTSW 16 21763202 missense possibly damaging 0.45
R5157:Ehhadh UTSW 16 21766511 missense probably benign 0.00
R5284:Ehhadh UTSW 16 21763344 splice site probably null
R5307:Ehhadh UTSW 16 21762692 missense probably benign 0.09
R5346:Ehhadh UTSW 16 21762790 missense probably damaging 1.00
R5872:Ehhadh UTSW 16 21766555 missense probably benign 0.01
R6762:Ehhadh UTSW 16 21762459 missense probably benign 0.01
R6960:Ehhadh UTSW 16 21762278 missense probably benign
R7153:Ehhadh UTSW 16 21766321 missense probably damaging 1.00
R7714:Ehhadh UTSW 16 21766390 missense probably damaging 0.98
X0018:Ehhadh UTSW 16 21762448 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGCTGTTTTCCAAGATGCTCCTGAG -3'
(R):5'- TCTGACTGGGTTGTGGGAACCA -3'

Sequencing Primer
(F):5'- TCCTGAGGGAGTTGACCAC -3'
(R):5'- TTGTGGGAACCACGCAC -3'
Posted On2014-04-24