Incidental Mutation 'R1601:Prdx5'
ID176184
Institutional Source Beutler Lab
Gene Symbol Prdx5
Ensembl Gene ENSMUSG00000024953
Gene Nameperoxiredoxin 5
SynonymsAOPP, PMP20, Prdx6, PrxV, AOEB166, peroxiredoxin V, PrxV
MMRRC Submission 039638-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R1601 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location6906697-6910106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6907558 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 140 (H140R)
Ref Sequence ENSEMBL: ENSMUSP00000135084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025904] [ENSMUST00000025906] [ENSMUST00000088257] [ENSMUST00000116551] [ENSMUST00000149261] [ENSMUST00000173091] [ENSMUST00000173635] [ENSMUST00000174786]
Predicted Effect probably benign
Transcript: ENSMUST00000025904
AA Change: H137R

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025904
Gene: ENSMUSG00000024953
AA Change: H137R

DomainStartEndE-ValueType
Pfam:Redoxin 53 206 1e-31 PFAM
Pfam:AhpC-TSA 54 189 8.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025906
SMART Domains Protein: ENSMUSP00000025906
Gene: ENSMUSG00000024955

DomainStartEndE-ValueType
internal_repeat_1 5 21 6.74e-5 PROSPERO
low complexity region 52 67 N/A INTRINSIC
ZnF_C4 76 147 2.16e-40 SMART
low complexity region 169 187 N/A INTRINSIC
internal_repeat_1 202 218 6.74e-5 PROSPERO
HOLI 229 391 9.21e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088257
SMART Domains Protein: ENSMUSP00000085591
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 112 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116551
SMART Domains Protein: ENSMUSP00000112250
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 112 1.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145300
Predicted Effect possibly damaging
Transcript: ENSMUST00000149261
AA Change: H140R

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135084
Gene: ENSMUSG00000024953
AA Change: H140R

DomainStartEndE-ValueType
Pfam:Redoxin 56 210 1.1e-31 PFAM
Pfam:AhpC-TSA 57 192 6.8e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172869
Predicted Effect probably benign
Transcript: ENSMUST00000173091
SMART Domains Protein: ENSMUSP00000134521
Gene: ENSMUSG00000024953

DomainStartEndE-ValueType
Pfam:Redoxin 53 99 3.3e-11 PFAM
Pfam:AhpC-TSA 54 100 9.3e-8 PFAM
Pfam:Redoxin 97 163 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173635
SMART Domains Protein: ENSMUSP00000134587
Gene: ENSMUSG00000024955

DomainStartEndE-ValueType
PDB:1LO1|A 1 21 6e-7 PDB
low complexity region 26 44 N/A INTRINSIC
Pfam:Hormone_recep 65 158 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174786
SMART Domains Protein: ENSMUSP00000134000
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 101 5.6e-11 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein may play an antioxidant protective role in different tissues under normal conditions and during inflammatory processes. This protein interacts with peroxisome receptor 1. The crystal structure of this protein in its reduced form has been resolved to 1.5 angstrom resolution. This gene uses alternate in-frame translation initiation sites to generate mitochondrial or peroxisomal/cytoplasmic forms. Three transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4933416C03Rik T C 10: 116,113,616 S2G probably damaging Het
Adgra2 T C 8: 27,110,018 probably null Het
Adgrb2 T C 4: 129,992,837 S257P probably benign Het
Adgre1 A G 17: 57,441,353 K518E probably benign Het
Anxa7 A T 14: 20,464,615 Y64* probably null Het
Arhgef7 A G 8: 11,782,638 probably null Het
Cdc42bpa T A 1: 180,065,001 Y243* probably null Het
Cdk14 C T 5: 5,135,378 V176M probably damaging Het
Cnbd2 A G 2: 156,333,631 E54G probably damaging Het
Crx T C 7: 15,867,811 probably null Het
Cyp24a1 A G 2: 170,485,691 F511L possibly damaging Het
Ddx11 A G 17: 66,150,385 M810V probably damaging Het
Dock10 T C 1: 80,549,802 T1077A probably benign Het
Dopey1 G A 9: 86,536,250 D2011N probably damaging Het
Ehhadh T A 16: 21,766,408 H241L probably benign Het
Enah A T 1: 181,919,620 L523* probably null Het
Fabp3 T C 4: 130,308,848 L24P probably benign Het
Fat2 A G 11: 55,282,010 S2626P probably benign Het
Fbxo4 A G 15: 3,968,965 M337T possibly damaging Het
Gas6 G T 8: 13,465,786 T662N probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hrh4 G A 18: 13,015,898 V106I possibly damaging Het
Ido2 G T 8: 24,576,189 H20Q possibly damaging Het
Ikbkap T A 4: 56,774,756 K740* probably null Het
Itga10 G T 3: 96,653,658 R613L possibly damaging Het
Itsn2 T C 12: 4,658,452 S836P probably benign Het
Kcng3 A T 17: 83,588,339 C233S probably damaging Het
Kdm3b A G 18: 34,808,731 Q625R probably damaging Het
Kidins220 A G 12: 25,005,088 S553G probably benign Het
Krt82 A T 15: 101,545,153 I266N probably damaging Het
Lama5 A T 2: 180,197,745 L736Q probably damaging Het
Lnx2 A G 5: 147,033,519 C138R probably damaging Het
Mcm5 T C 8: 75,119,354 C397R possibly damaging Het
Me1 A C 9: 86,678,012 Y52D probably damaging Het
Muc4 C A 16: 32,755,501 probably benign Het
Myo18b G T 5: 112,871,498 Q638K possibly damaging Het
Ncapd2 A G 6: 125,185,772 L170P probably damaging Het
Neb A T 2: 52,287,252 L1359* probably null Het
Nomo1 C A 7: 46,046,955 S299Y probably damaging Het
Olfr1359 C A 13: 21,703,226 T75K probably damaging Het
Olfr1509 A C 14: 52,450,442 T10P probably benign Het
Olfr322 A T 11: 58,666,077 R173W probably damaging Het
Olfr57 A T 10: 79,035,504 Y236F possibly damaging Het
Onecut1 A T 9: 74,862,691 H132L probably benign Het
Paqr3 A G 5: 97,111,389 Y19H probably benign Het
Prox1 T C 1: 190,161,006 D414G probably damaging Het
Ptprh T G 7: 4,552,638 E774A probably damaging Het
Rnpepl1 A T 1: 92,917,222 D412V possibly damaging Het
Sars2 C T 7: 28,748,971 T259M probably benign Het
Sbf2 T C 7: 110,340,076 probably null Het
Sbno2 C T 10: 80,060,492 R898H probably damaging Het
Smox C A 2: 131,520,174 T172N probably damaging Het
Tdrd9 C T 12: 112,023,253 R341* probably null Het
Thrap3 C G 4: 126,180,101 G284A probably damaging Het
Tmtc4 A G 14: 122,944,826 V271A probably benign Het
Trank1 A G 9: 111,373,477 T1637A probably damaging Het
Tspan5 T A 3: 138,896,835 I166N probably damaging Het
Vps13b T C 15: 35,642,436 V1398A probably benign Het
Xbp1 C T 11: 5,521,975 R34W probably damaging Het
Other mutations in Prdx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02755:Prdx5 APN 19 6909595 missense probably benign 0.06
R1886:Prdx5 UTSW 19 6908190 missense probably benign 0.26
R3713:Prdx5 UTSW 19 6908109 missense probably damaging 1.00
R3849:Prdx5 UTSW 19 6906850 missense probably damaging 1.00
R4420:Prdx5 UTSW 19 6907964 unclassified probably null
R4622:Prdx5 UTSW 19 6906973 unclassified probably benign
R7211:Prdx5 UTSW 19 6907590 missense probably damaging 1.00
R7423:Prdx5 UTSW 19 6910002 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGCTGCTCCCATATAACATGTCCC -3'
(R):5'- AAATCTGATAGCTCTGATTGACGCTGG -3'

Sequencing Primer
(F):5'- gctcagtccccacgacc -3'
(R):5'- gtagccaaggcaaaaaggaag -3'
Posted On2014-04-24