Mutagenetix > Incidental Mutations

Incidental Mutation 'R1602:Ptpa'

176187

Institutional Source

Beutler Lab

Gene Symbol

Ptpa

Ensembl Gene

ENSMUSG00000039515

Gene Name

protein phosphatase 2 protein activator

Synonyms

Ppp2r4, 2610042B21Rik

MMRRC Submission

039639-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R1602 (G1)

Quality Score

201

Status

Validated

Chromosome

Chromosomal Location

30416039-30447806 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 30437590 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 119 (A119S)

Ref Sequence

ENSEMBL: ENSMUSP00000109233 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042055] [ENSMUST00000113601] [ENSMUST00000113603] [ENSMUST00000131476]

Predicted Effect

probably benign
Transcript: ENSMUST00000042055
AA Change: A161S

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000046837
Gene: ENSMUSG00000039515
AA Change: A161S

Domain	Start	End	E-Value	Type
low complexity region	8	20	N/A	INTRINSIC
Pfam:PTPA	26	319	1.5e-126	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113601

SMART Domains

Protein: ENSMUSP00000109231
Gene: ENSMUSG00000039515

Domain	Start	End	E-Value	Type
low complexity region	8	20	N/A	INTRINSIC
Pfam:PTPA	38	104	5.7e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113603
AA Change: A119S

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000109233
Gene: ENSMUSG00000039515
AA Change: A119S

Domain	Start	End	E-Value	Type
low complexity region	8	20	N/A	INTRINSIC
Pfam:PTPA	64	280	5.7e-90	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125561

SMART Domains

Protein: ENSMUSP00000114290
Gene: ENSMUSG00000039515

Domain	Start	End	E-Value	Type
Pfam:PTPA	1	125	6.1e-57	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125743

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128516

Predicted Effect

probably benign
Transcript: ENSMUST00000131476

SMART Domains

Protein: ENSMUSP00000116268
Gene: ENSMUSG00000039515

Domain	Start	End	E-Value	Type
Pfam:PTPA	1	61	8.3e-28	PFAM

Meta Mutation Damage Score

0.2132

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.4%

Validation Efficiency

91% (49/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase 2A is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2A holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B' family. This gene encodes a specific phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase 2A. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd12	A	T	17: 65,983,688	Y1583*	probably null	Het
Ankrd34c	T	C	9: 89,729,005	T428A	possibly damaging	Het
Arfgef1	G	C	1: 10,204,890	I312M	probably benign	Het
Atr	T	C	9: 95,951,557	L2620P	probably damaging	Het
Ccdc110	A	G	8: 45,938,918	Y54C	probably benign	Het
Cecr2	T	C	6: 120,755,587	V480A	possibly damaging	Het
Chfr	A	G	5: 110,151,665	D308G	probably benign	Het
Cit	T	A	5: 115,997,730	I1919N	probably damaging	Het
Ctsc	T	A	7: 88,278,304	D34E	possibly damaging	Het
Diaph3	T	A	14: 87,091,158		probably benign	Het
Dnah6	T	A	6: 73,067,469	I3220F	probably damaging	Het
Elmod3	A	G	6: 72,569,259		probably null	Het
Fam35a	A	G	14: 34,267,650	I433T	probably damaging	Het
Fgd5	T	C	6: 92,066,184	V1215A	possibly damaging	Het
Filip1	T	C	9: 79,820,591	M249V	probably damaging	Het
Fmn1	C	T	2: 113,525,623	P803L	unknown	Het
Gcfc2	A	G	6: 81,944,420	K469R	probably damaging	Het
Gm12169	T	C	11: 46,535,588	I174T	probably benign	Het
Gm6803	C	A	12: 88,018,364	E136D	probably benign	Het
Gm8994	G	A	6: 136,328,780	A80T	probably damaging	Het
Itgad	A	G	7: 128,190,939	T637A	probably damaging	Het
Kank2	T	C	9: 21,769,837	S799G	probably damaging	Het
Kcnc4	A	T	3: 107,448,204	D309E	possibly damaging	Het
Lamc2	G	A	1: 153,127,028	T1069M	probably benign	Het
Lepr	T	A	4: 101,745,645	M210K	possibly damaging	Het
Lig3	T	C	11: 82,792,194		probably null	Het
Oat	G	T	7: 132,570,007	T33K	probably benign	Het
Olfr1356	T	A	10: 78,846,968	M316L	probably benign	Het
Olfr1368	T	C	13: 21,142,650	M136V	probably damaging	Het
Olfr32	A	G	2: 90,139,055	F28S	probably damaging	Het
Pcnx3	G	T	19: 5,672,515	A1383E	probably damaging	Het
Pctp	T	C	11: 89,988,735	Y100C	probably damaging	Het
Pex6	G	T	17: 46,712,137	R213L	probably benign	Het
Phlpp2	T	C	8: 109,934,023	L770S	possibly damaging	Het
Pkn2	A	T	3: 142,853,538	D75E	possibly damaging	Het
Pla2g12b	T	C	10: 59,421,553		probably null	Het
Plch2	C	T	4: 154,984,450	V1135I	probably damaging	Het
Pskh1	T	A	8: 105,912,821	S44R	probably benign	Het
Slfn3	A	G	11: 83,212,715	I137M	probably damaging	Het
St6galnac1	A	T	11: 116,769,287	S67T	probably benign	Het
Treml1	A	G	17: 48,364,889	E137G	probably damaging	Het
Ubr2	A	C	17: 46,941,061	C1518G	probably benign	Het
Vmn2r55	A	T	7: 12,652,644	C470S	probably damaging	Het

Other mutations in Ptpa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02066:Ptpa	APN	2	30443296	missense	possibly damaging	0.83
IGL02073:Ptpa	APN	2	30443350	missense	probably damaging	1.00
IGL02201:Ptpa	APN	2	30446377	missense	possibly damaging	0.91
R3962:Ptpa	UTSW	2	30435660	missense	probably damaging	1.00
R4080:Ptpa	UTSW	2	30443305	missense	probably damaging	1.00
R5186:Ptpa	UTSW	2	30438355	critical splice donor site	probably null
R6622:Ptpa	UTSW	2	30437577	missense	probably damaging	1.00
R8190:Ptpa	UTSW	2	30438339	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGAAGAGTGCCAGTGCTTGTG -3'
(R):5'- ATGGAGACCAGGCTCAGTGTCATC -3'

Sequencing Primer
(F):5'- GCTTGTTGAAAGGCTCAGGTC -3'
(R):5'- CTCTTCTATAAGAGGCAGGCAGTG -3'

Posted On

2014-04-24