Incidental Mutation 'R1602:Ptpa'
ID 176187
Institutional Source Beutler Lab
Gene Symbol Ptpa
Ensembl Gene ENSMUSG00000039515
Gene Name protein phosphatase 2 protein activator
Synonyms Ppp2r4, 2610042B21Rik
MMRRC Submission 039639-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock # R1602 (G1)
Quality Score 201
Status Validated
Chromosome 2
Chromosomal Location 30416039-30447806 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 30437590 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 119 (A119S)
Ref Sequence ENSEMBL: ENSMUSP00000109233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042055] [ENSMUST00000113601] [ENSMUST00000113603] [ENSMUST00000131476]
AlphaFold P58389
Predicted Effect probably benign
Transcript: ENSMUST00000042055
AA Change: A161S

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000046837
Gene: ENSMUSG00000039515
AA Change: A161S

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:PTPA 26 319 1.5e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113601
SMART Domains Protein: ENSMUSP00000109231
Gene: ENSMUSG00000039515

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:PTPA 38 104 5.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113603
AA Change: A119S

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109233
Gene: ENSMUSG00000039515
AA Change: A119S

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:PTPA 64 280 5.7e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125561
SMART Domains Protein: ENSMUSP00000114290
Gene: ENSMUSG00000039515

DomainStartEndE-ValueType
Pfam:PTPA 1 125 6.1e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128516
Predicted Effect probably benign
Transcript: ENSMUST00000131476
SMART Domains Protein: ENSMUSP00000116268
Gene: ENSMUSG00000039515

DomainStartEndE-ValueType
Pfam:PTPA 1 61 8.3e-28 PFAM
Meta Mutation Damage Score 0.2132 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase 2A is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2A holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B' family. This gene encodes a specific phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase 2A. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 A T 17: 65,983,688 Y1583* probably null Het
Ankrd34c T C 9: 89,729,005 T428A possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Atr T C 9: 95,951,557 L2620P probably damaging Het
Ccdc110 A G 8: 45,938,918 Y54C probably benign Het
Cecr2 T C 6: 120,755,587 V480A possibly damaging Het
Chfr A G 5: 110,151,665 D308G probably benign Het
Cit T A 5: 115,997,730 I1919N probably damaging Het
Ctsc T A 7: 88,278,304 D34E possibly damaging Het
Diaph3 T A 14: 87,091,158 probably benign Het
Dnah6 T A 6: 73,067,469 I3220F probably damaging Het
Elmod3 A G 6: 72,569,259 probably null Het
Fam35a A G 14: 34,267,650 I433T probably damaging Het
Fgd5 T C 6: 92,066,184 V1215A possibly damaging Het
Filip1 T C 9: 79,820,591 M249V probably damaging Het
Fmn1 C T 2: 113,525,623 P803L unknown Het
Gcfc2 A G 6: 81,944,420 K469R probably damaging Het
Gm12169 T C 11: 46,535,588 I174T probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Gm8994 G A 6: 136,328,780 A80T probably damaging Het
Itgad A G 7: 128,190,939 T637A probably damaging Het
Kank2 T C 9: 21,769,837 S799G probably damaging Het
Kcnc4 A T 3: 107,448,204 D309E possibly damaging Het
Lamc2 G A 1: 153,127,028 T1069M probably benign Het
Lepr T A 4: 101,745,645 M210K possibly damaging Het
Lig3 T C 11: 82,792,194 probably null Het
Oat G T 7: 132,570,007 T33K probably benign Het
Olfr1356 T A 10: 78,846,968 M316L probably benign Het
Olfr1368 T C 13: 21,142,650 M136V probably damaging Het
Olfr32 A G 2: 90,139,055 F28S probably damaging Het
Pcnx3 G T 19: 5,672,515 A1383E probably damaging Het
Pctp T C 11: 89,988,735 Y100C probably damaging Het
Pex6 G T 17: 46,712,137 R213L probably benign Het
Phlpp2 T C 8: 109,934,023 L770S possibly damaging Het
Pkn2 A T 3: 142,853,538 D75E possibly damaging Het
Pla2g12b T C 10: 59,421,553 probably null Het
Plch2 C T 4: 154,984,450 V1135I probably damaging Het
Pskh1 T A 8: 105,912,821 S44R probably benign Het
Slfn3 A G 11: 83,212,715 I137M probably damaging Het
St6galnac1 A T 11: 116,769,287 S67T probably benign Het
Treml1 A G 17: 48,364,889 E137G probably damaging Het
Ubr2 A C 17: 46,941,061 C1518G probably benign Het
Vmn2r55 A T 7: 12,652,644 C470S probably damaging Het
Other mutations in Ptpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02066:Ptpa APN 2 30443296 missense possibly damaging 0.83
IGL02073:Ptpa APN 2 30443350 missense probably damaging 1.00
IGL02201:Ptpa APN 2 30446377 missense possibly damaging 0.91
R3962:Ptpa UTSW 2 30435660 missense probably damaging 1.00
R4080:Ptpa UTSW 2 30443305 missense probably damaging 1.00
R5186:Ptpa UTSW 2 30438355 critical splice donor site probably null
R6622:Ptpa UTSW 2 30437577 missense probably damaging 1.00
R7943:Ptpa UTSW 2 30432044 missense probably damaging 1.00
R8190:Ptpa UTSW 2 30438339 missense probably damaging 1.00
R9147:Ptpa UTSW 2 30438243 missense probably damaging 1.00
R9147:Ptpa UTSW 2 30438244 missense probably benign 0.21
R9148:Ptpa UTSW 2 30438243 missense probably damaging 1.00
R9148:Ptpa UTSW 2 30438244 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AGGAAGAGTGCCAGTGCTTGTG -3'
(R):5'- ATGGAGACCAGGCTCAGTGTCATC -3'

Sequencing Primer
(F):5'- GCTTGTTGAAAGGCTCAGGTC -3'
(R):5'- CTCTTCTATAAGAGGCAGGCAGTG -3'
Posted On 2014-04-24