Incidental Mutation 'R1602:Olfr32'
ID176188
Institutional Source Beutler Lab
Gene Symbol Olfr32
Ensembl Gene ENSMUSG00000075066
Gene Nameolfactory receptor 32
SynonymsMOR227-9_p, GA_x6K02T2Q125-51573576-51572650, MOR227-7P, MTPCR05
MMRRC Submission 039639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1602 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90136273-90142296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90139055 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 28 (F28S)
Ref Sequence ENSEMBL: ENSMUSP00000149175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099755] [ENSMUST00000213293] [ENSMUST00000214973] [ENSMUST00000215153] [ENSMUST00000215659] [ENSMUST00000215765]
Predicted Effect probably damaging
Transcript: ENSMUST00000099755
AA Change: F28S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097344
Gene: ENSMUSG00000075066
AA Change: F28S

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.7e-52 PFAM
Pfam:7tm_1 38 284 6.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213293
AA Change: F28S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214973
AA Change: F28S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215153
AA Change: F28S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215659
AA Change: F28S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000215765
AA Change: F28S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 A T 17: 65,983,688 Y1583* probably null Het
Ankrd34c T C 9: 89,729,005 T428A possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Atr T C 9: 95,951,557 L2620P probably damaging Het
Ccdc110 A G 8: 45,938,918 Y54C probably benign Het
Cecr2 T C 6: 120,755,587 V480A possibly damaging Het
Chfr A G 5: 110,151,665 D308G probably benign Het
Cit T A 5: 115,997,730 I1919N probably damaging Het
Ctsc T A 7: 88,278,304 D34E possibly damaging Het
Diaph3 T A 14: 87,091,158 probably benign Het
Dnah6 T A 6: 73,067,469 I3220F probably damaging Het
Elmod3 A G 6: 72,569,259 probably null Het
Fam35a A G 14: 34,267,650 I433T probably damaging Het
Fgd5 T C 6: 92,066,184 V1215A possibly damaging Het
Filip1 T C 9: 79,820,591 M249V probably damaging Het
Fmn1 C T 2: 113,525,623 P803L unknown Het
Gcfc2 A G 6: 81,944,420 K469R probably damaging Het
Gm12169 T C 11: 46,535,588 I174T probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Gm8994 G A 6: 136,328,780 A80T probably damaging Het
Itgad A G 7: 128,190,939 T637A probably damaging Het
Kank2 T C 9: 21,769,837 S799G probably damaging Het
Kcnc4 A T 3: 107,448,204 D309E possibly damaging Het
Lamc2 G A 1: 153,127,028 T1069M probably benign Het
Lepr T A 4: 101,745,645 M210K possibly damaging Het
Lig3 T C 11: 82,792,194 probably null Het
Oat G T 7: 132,570,007 T33K probably benign Het
Olfr1356 T A 10: 78,846,968 M316L probably benign Het
Olfr1368 T C 13: 21,142,650 M136V probably damaging Het
Pcnx3 G T 19: 5,672,515 A1383E probably damaging Het
Pctp T C 11: 89,988,735 Y100C probably damaging Het
Pex6 G T 17: 46,712,137 R213L probably benign Het
Phlpp2 T C 8: 109,934,023 L770S possibly damaging Het
Pkn2 A T 3: 142,853,538 D75E possibly damaging Het
Pla2g12b T C 10: 59,421,553 probably null Het
Plch2 C T 4: 154,984,450 V1135I probably damaging Het
Pskh1 T A 8: 105,912,821 S44R probably benign Het
Ptpa G T 2: 30,437,590 A119S probably benign Het
Slfn3 A G 11: 83,212,715 I137M probably damaging Het
St6galnac1 A T 11: 116,769,287 S67T probably benign Het
Treml1 A G 17: 48,364,889 E137G probably damaging Het
Ubr2 A C 17: 46,941,061 C1518G probably benign Het
Vmn2r55 A T 7: 12,652,644 C470S probably damaging Het
Other mutations in Olfr32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr32 APN 2 90139074 missense probably benign 0.30
IGL01976:Olfr32 APN 2 90138924 missense probably damaging 1.00
IGL02076:Olfr32 APN 2 90138815 missense probably damaging 1.00
IGL03030:Olfr32 APN 2 90138662 missense possibly damaging 0.93
IGL03235:Olfr32 APN 2 90139070 missense possibly damaging 0.88
IGL03410:Olfr32 APN 2 90139145 start gained probably benign
R1240:Olfr32 UTSW 2 90138813 missense possibly damaging 0.48
R1511:Olfr32 UTSW 2 90138404 missense probably benign 0.13
R1828:Olfr32 UTSW 2 90138587 missense probably damaging 0.99
R2023:Olfr32 UTSW 2 90138856 nonsense probably null
R2177:Olfr32 UTSW 2 90138464 missense possibly damaging 0.70
R2679:Olfr32 UTSW 2 90138545 missense possibly damaging 0.93
R4490:Olfr32 UTSW 2 90138917 missense probably damaging 0.97
R4585:Olfr32 UTSW 2 90138214 missense probably benign 0.01
R4586:Olfr32 UTSW 2 90138214 missense probably benign 0.01
R4649:Olfr32 UTSW 2 90139088 missense probably damaging 0.99
R4688:Olfr32 UTSW 2 90138999 missense possibly damaging 0.80
R4694:Olfr32 UTSW 2 90138249 nonsense probably null
R5245:Olfr32 UTSW 2 90138262 missense probably damaging 1.00
R5509:Olfr32 UTSW 2 90138892 missense probably damaging 1.00
R5991:Olfr32 UTSW 2 90138234 nonsense probably null
R6004:Olfr32 UTSW 2 90138999 missense probably benign 0.32
R6128:Olfr32 UTSW 2 90138610 nonsense probably null
R6519:Olfr32 UTSW 2 90138812 missense possibly damaging 0.90
R7472:Olfr32 UTSW 2 90138324 missense probably damaging 1.00
R7892:Olfr32 UTSW 2 90138492 missense probably benign 0.00
R7975:Olfr32 UTSW 2 90138492 missense probably benign 0.00
R8046:Olfr32 UTSW 2 90138815 missense probably damaging 1.00
X0066:Olfr32 UTSW 2 90138390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCTGAGCTAGGCAGCCCTTTG -3'
(R):5'- CCCTGTGCTTCTGAGTGATGATACG -3'

Sequencing Primer
(F):5'- GCAGCCCTTTGGAGAGATG -3'
(R):5'- AGCTTCCGTGAATGTCTGAC -3'
Posted On2014-04-24