Incidental Mutation 'R1602:Elmod3'
ID176197
Institutional Source Beutler Lab
Gene Symbol Elmod3
Ensembl Gene ENSMUSG00000056698
Gene NameELMO/CED-12 domain containing 3
SynonymsELMOD3, RBM29, Rbed1, C330008I15Rik
MMRRC Submission 039639-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1602 (G1)
Quality Score206
Status Validated
Chromosome6
Chromosomal Location72565922-72598413 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 72569259 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070990] [ENSMUST00000114069] [ENSMUST00000141833] [ENSMUST00000148108]
Predicted Effect probably null
Transcript: ENSMUST00000070990
SMART Domains Protein: ENSMUSP00000067768
Gene: ENSMUSG00000056698

DomainStartEndE-ValueType
Pfam:ELMO_CED12 151 314 3.3e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114069
SMART Domains Protein: ENSMUSP00000109703
Gene: ENSMUSG00000056698

DomainStartEndE-ValueType
Pfam:ELMO_CED12 154 313 1.2e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000141833
Predicted Effect probably benign
Transcript: ENSMUST00000148108
Meta Mutation Damage Score 0.9498 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the engulfment and cell motility family of GTPase-activating proteins that regulate Arf GTPase proteins. Members of this family are defined by a conserved engulfment and cell motility domain. In rat cochlea, the encoded protein is found in stereocilia, kinocilia and cuticular plate of developing hair cells suggesting a function for this protein in cochlear sensory cells. An allelic variant of this family has been associated with autosomal recessive nonsyndromic deafness-88 in humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 A T 17: 65,983,688 Y1583* probably null Het
Ankrd34c T C 9: 89,729,005 T428A possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Atr T C 9: 95,951,557 L2620P probably damaging Het
Ccdc110 A G 8: 45,938,918 Y54C probably benign Het
Cecr2 T C 6: 120,755,587 V480A possibly damaging Het
Chfr A G 5: 110,151,665 D308G probably benign Het
Cit T A 5: 115,997,730 I1919N probably damaging Het
Ctsc T A 7: 88,278,304 D34E possibly damaging Het
Diaph3 T A 14: 87,091,158 probably benign Het
Dnah6 T A 6: 73,067,469 I3220F probably damaging Het
Fam35a A G 14: 34,267,650 I433T probably damaging Het
Fgd5 T C 6: 92,066,184 V1215A possibly damaging Het
Filip1 T C 9: 79,820,591 M249V probably damaging Het
Fmn1 C T 2: 113,525,623 P803L unknown Het
Gcfc2 A G 6: 81,944,420 K469R probably damaging Het
Gm12169 T C 11: 46,535,588 I174T probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Gm8994 G A 6: 136,328,780 A80T probably damaging Het
Itgad A G 7: 128,190,939 T637A probably damaging Het
Kank2 T C 9: 21,769,837 S799G probably damaging Het
Kcnc4 A T 3: 107,448,204 D309E possibly damaging Het
Lamc2 G A 1: 153,127,028 T1069M probably benign Het
Lepr T A 4: 101,745,645 M210K possibly damaging Het
Lig3 T C 11: 82,792,194 probably null Het
Oat G T 7: 132,570,007 T33K probably benign Het
Olfr1356 T A 10: 78,846,968 M316L probably benign Het
Olfr1368 T C 13: 21,142,650 M136V probably damaging Het
Olfr32 A G 2: 90,139,055 F28S probably damaging Het
Pcnx3 G T 19: 5,672,515 A1383E probably damaging Het
Pctp T C 11: 89,988,735 Y100C probably damaging Het
Pex6 G T 17: 46,712,137 R213L probably benign Het
Phlpp2 T C 8: 109,934,023 L770S possibly damaging Het
Pkn2 A T 3: 142,853,538 D75E possibly damaging Het
Pla2g12b T C 10: 59,421,553 probably null Het
Plch2 C T 4: 154,984,450 V1135I probably damaging Het
Pskh1 T A 8: 105,912,821 S44R probably benign Het
Ptpa G T 2: 30,437,590 A119S probably benign Het
Slfn3 A G 11: 83,212,715 I137M probably damaging Het
St6galnac1 A T 11: 116,769,287 S67T probably benign Het
Treml1 A G 17: 48,364,889 E137G probably damaging Het
Ubr2 A C 17: 46,941,061 C1518G probably benign Het
Vmn2r55 A T 7: 12,652,644 C470S probably damaging Het
Other mutations in Elmod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:Elmod3 APN 6 72586507 missense possibly damaging 0.66
IGL02725:Elmod3 APN 6 72594775 missense probably damaging 0.96
IGL03089:Elmod3 APN 6 72569316 missense probably damaging 1.00
R0092:Elmod3 UTSW 6 72566809 missense probably benign
R0173:Elmod3 UTSW 6 72577588 missense probably damaging 1.00
R0925:Elmod3 UTSW 6 72568938 missense probably damaging 1.00
R3147:Elmod3 UTSW 6 72586502 missense probably benign 0.01
R5594:Elmod3 UTSW 6 72594816 unclassified probably benign
R5870:Elmod3 UTSW 6 72594738 critical splice donor site probably null
R6045:Elmod3 UTSW 6 72568868 missense probably benign
R7173:Elmod3 UTSW 6 72577252 critical splice donor site probably null
R7229:Elmod3 UTSW 6 72594753 missense probably benign 0.09
Z1177:Elmod3 UTSW 6 72566689 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ATGACCTTCTGCCGCCGATTACAC -3'
(R):5'- GCTTAGTTTCTGCCAGTCACACGAG -3'

Sequencing Primer
(F):5'- ccccacccctctccacc -3'
(R):5'- GCCAGTCACACGAGGAGTAG -3'
Posted On2014-04-24