Incidental Mutation 'R1602:Vmn2r55'
ID176203
Institutional Source Beutler Lab
Gene Symbol Vmn2r55
Ensembl Gene ENSMUSG00000091045
Gene Namevomeronasal 2, receptor 55
Synonyms
MMRRC Submission 039639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1602 (G1)
Quality Score167
Status Not validated
Chromosome7
Chromosomal Location12651706-12684991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12652644 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 470 (C470S)
Ref Sequence ENSEMBL: ENSMUSP00000133483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172743]
Predicted Effect probably damaging
Transcript: ENSMUST00000172743
AA Change: C470S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133483
Gene: ENSMUSG00000091045
AA Change: C470S

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.4e-57 PFAM
Pfam:7tm_3 525 762 3.7e-54 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 91% (49/54)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 A T 17: 65,983,688 Y1583* probably null Het
Ankrd34c T C 9: 89,729,005 T428A possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Atr T C 9: 95,951,557 L2620P probably damaging Het
Ccdc110 A G 8: 45,938,918 Y54C probably benign Het
Cecr2 T C 6: 120,755,587 V480A possibly damaging Het
Chfr A G 5: 110,151,665 D308G probably benign Het
Cit T A 5: 115,997,730 I1919N probably damaging Het
Ctsc T A 7: 88,278,304 D34E possibly damaging Het
Diaph3 T A 14: 87,091,158 probably benign Het
Dnah6 T A 6: 73,067,469 I3220F probably damaging Het
Elmod3 A G 6: 72,569,259 probably null Het
Fam35a A G 14: 34,267,650 I433T probably damaging Het
Fgd5 T C 6: 92,066,184 V1215A possibly damaging Het
Filip1 T C 9: 79,820,591 M249V probably damaging Het
Fmn1 C T 2: 113,525,623 P803L unknown Het
Gcfc2 A G 6: 81,944,420 K469R probably damaging Het
Gm12169 T C 11: 46,535,588 I174T probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Gm8994 G A 6: 136,328,780 A80T probably damaging Het
Itgad A G 7: 128,190,939 T637A probably damaging Het
Kank2 T C 9: 21,769,837 S799G probably damaging Het
Kcnc4 A T 3: 107,448,204 D309E possibly damaging Het
Lamc2 G A 1: 153,127,028 T1069M probably benign Het
Lepr T A 4: 101,745,645 M210K possibly damaging Het
Lig3 T C 11: 82,792,194 probably null Het
Oat G T 7: 132,570,007 T33K probably benign Het
Olfr1356 T A 10: 78,846,968 M316L probably benign Het
Olfr1368 T C 13: 21,142,650 M136V probably damaging Het
Olfr32 A G 2: 90,139,055 F28S probably damaging Het
Pcnx3 G T 19: 5,672,515 A1383E probably damaging Het
Pctp T C 11: 89,988,735 Y100C probably damaging Het
Pex6 G T 17: 46,712,137 R213L probably benign Het
Phlpp2 T C 8: 109,934,023 L770S possibly damaging Het
Pkn2 A T 3: 142,853,538 D75E possibly damaging Het
Pla2g12b T C 10: 59,421,553 probably null Het
Plch2 C T 4: 154,984,450 V1135I probably damaging Het
Pskh1 T A 8: 105,912,821 S44R probably benign Het
Ptpa G T 2: 30,437,590 A119S probably benign Het
Slfn3 A G 11: 83,212,715 I137M probably damaging Het
St6galnac1 A T 11: 116,769,287 S67T probably benign Het
Treml1 A G 17: 48,364,889 E137G probably damaging Het
Ubr2 A C 17: 46,941,061 C1518G probably benign Het
Other mutations in Vmn2r55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02684:Vmn2r55 APN 7 12670960 missense probably damaging 1.00
IGL03035:Vmn2r55 APN 7 12670816 missense probably benign 0.01
IGL03115:Vmn2r55 APN 7 12670631 missense probably damaging 1.00
IGL03251:Vmn2r55 APN 7 12671193 splice site probably benign
R0140:Vmn2r55 UTSW 7 12668177 missense possibly damaging 0.58
R0511:Vmn2r55 UTSW 7 12671018 missense possibly damaging 0.88
R1281:Vmn2r55 UTSW 7 12670898 missense probably benign 0.02
R1564:Vmn2r55 UTSW 7 12684751 missense probably damaging 1.00
R1785:Vmn2r55 UTSW 7 12668184 missense probably damaging 0.98
R2939:Vmn2r55 UTSW 7 12651905 missense probably damaging 1.00
R2993:Vmn2r55 UTSW 7 12684955 missense probably damaging 1.00
R3151:Vmn2r55 UTSW 7 12670707 missense probably benign 0.06
R4272:Vmn2r55 UTSW 7 12668179 missense probably benign 0.38
R4589:Vmn2r55 UTSW 7 12670895 missense probably damaging 0.99
R4624:Vmn2r55 UTSW 7 12670700 missense possibly damaging 0.83
R4965:Vmn2r55 UTSW 7 12670551 missense possibly damaging 0.91
R5294:Vmn2r55 UTSW 7 12651864 missense probably damaging 1.00
R5364:Vmn2r55 UTSW 7 12670903 missense possibly damaging 0.51
R5395:Vmn2r55 UTSW 7 12651947 missense probably damaging 1.00
R5401:Vmn2r55 UTSW 7 12651944 missense probably benign
R5701:Vmn2r55 UTSW 7 12670565 missense probably benign 0.00
R5771:Vmn2r55 UTSW 7 12671032 missense probably damaging 1.00
R5846:Vmn2r55 UTSW 7 12670565 missense probably benign 0.05
R6148:Vmn2r55 UTSW 7 12668142 missense probably benign 0.01
R6159:Vmn2r55 UTSW 7 12651771 missense probably damaging 1.00
R6541:Vmn2r55 UTSW 7 12671012 missense probably damaging 1.00
R7286:Vmn2r55 UTSW 7 12652073 missense probably damaging 0.99
R7483:Vmn2r55 UTSW 7 12670828 missense probably benign 0.00
R8269:Vmn2r55 UTSW 7 12670658 missense possibly damaging 0.86
R8749:Vmn2r55 UTSW 7 12651869 missense probably damaging 1.00
R8914:Vmn2r55 UTSW 7 12671097 missense probably benign 0.09
Z1177:Vmn2r55 UTSW 7 12651837 missense possibly damaging 0.83
Z1177:Vmn2r55 UTSW 7 12671179 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGTTGTTGGCCCTAACCACAGG -3'
(R):5'- CGTGTTCAAAGCCAGGTTGTGTTAC -3'

Sequencing Primer
(F):5'- TATCCCGGTGCTTCAGGAAC -3'
(R):5'- CAGTACACACTTTTAGGACAGATAC -3'
Posted On2014-04-24