Incidental Mutation 'R1602:Ccdc110'
ID176207
Institutional Source Beutler Lab
Gene Symbol Ccdc110
Ensembl Gene ENSMUSG00000071104
Gene Namecoiled-coil domain containing 110
SynonymsLOC212392
MMRRC Submission 039639-MU
Accession Numbers

Genbank: NM_001033246; MGI: 2685018

Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1602 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location45934619-45944145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45938918 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 54 (Y54C)
Ref Sequence ENSEMBL: ENSMUSP00000092964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095326] [ENSMUST00000174815]
Predicted Effect probably benign
Transcript: ENSMUST00000095326
AA Change: Y54C

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092964
Gene: ENSMUSG00000071104
AA Change: Y54C

DomainStartEndE-ValueType
coiled coil region 442 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174815
Meta Mutation Damage Score 0.0830 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 91% (49/54)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 A T 17: 65,983,688 Y1583* probably null Het
Ankrd34c T C 9: 89,729,005 T428A possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Atr T C 9: 95,951,557 L2620P probably damaging Het
Cecr2 T C 6: 120,755,587 V480A possibly damaging Het
Chfr A G 5: 110,151,665 D308G probably benign Het
Cit T A 5: 115,997,730 I1919N probably damaging Het
Ctsc T A 7: 88,278,304 D34E possibly damaging Het
Diaph3 T A 14: 87,091,158 probably benign Het
Dnah6 T A 6: 73,067,469 I3220F probably damaging Het
Elmod3 A G 6: 72,569,259 probably null Het
Fam35a A G 14: 34,267,650 I433T probably damaging Het
Fgd5 T C 6: 92,066,184 V1215A possibly damaging Het
Filip1 T C 9: 79,820,591 M249V probably damaging Het
Fmn1 C T 2: 113,525,623 P803L unknown Het
Gcfc2 A G 6: 81,944,420 K469R probably damaging Het
Gm12169 T C 11: 46,535,588 I174T probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Gm8994 G A 6: 136,328,780 A80T probably damaging Het
Itgad A G 7: 128,190,939 T637A probably damaging Het
Kank2 T C 9: 21,769,837 S799G probably damaging Het
Kcnc4 A T 3: 107,448,204 D309E possibly damaging Het
Lamc2 G A 1: 153,127,028 T1069M probably benign Het
Lepr T A 4: 101,745,645 M210K possibly damaging Het
Lig3 T C 11: 82,792,194 probably null Het
Oat G T 7: 132,570,007 T33K probably benign Het
Olfr1356 T A 10: 78,846,968 M316L probably benign Het
Olfr1368 T C 13: 21,142,650 M136V probably damaging Het
Olfr32 A G 2: 90,139,055 F28S probably damaging Het
Pcnx3 G T 19: 5,672,515 A1383E probably damaging Het
Pctp T C 11: 89,988,735 Y100C probably damaging Het
Pex6 G T 17: 46,712,137 R213L probably benign Het
Phlpp2 T C 8: 109,934,023 L770S possibly damaging Het
Pkn2 A T 3: 142,853,538 D75E possibly damaging Het
Pla2g12b T C 10: 59,421,553 probably null Het
Plch2 C T 4: 154,984,450 V1135I probably damaging Het
Pskh1 T A 8: 105,912,821 S44R probably benign Het
Ptpa G T 2: 30,437,590 A119S probably benign Het
Slfn3 A G 11: 83,212,715 I137M probably damaging Het
St6galnac1 A T 11: 116,769,287 S67T probably benign Het
Treml1 A G 17: 48,364,889 E137G probably damaging Het
Ubr2 A C 17: 46,941,061 C1518G probably benign Het
Vmn2r55 A T 7: 12,652,644 C470S probably damaging Het
Other mutations in Ccdc110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Ccdc110 APN 8 45942124 missense possibly damaging 0.76
IGL02175:Ccdc110 APN 8 45940623 missense probably benign 0.07
IGL02471:Ccdc110 APN 8 45941756 missense probably benign 0.14
IGL02524:Ccdc110 APN 8 45941942 missense probably benign
IGL02887:Ccdc110 APN 8 45943184 missense probably benign 0.01
IGL03227:Ccdc110 APN 8 45941549 missense probably damaging 1.00
IGL03238:Ccdc110 APN 8 45941822 missense probably benign 0.00
droll UTSW 8 45942827 missense probably benign 0.10
humorless UTSW 8 45943450 missense probably benign 0.03
R0049:Ccdc110 UTSW 8 45942626 missense probably damaging 1.00
R0049:Ccdc110 UTSW 8 45942626 missense probably damaging 1.00
R0110:Ccdc110 UTSW 8 45935157 missense probably benign 0.00
R0189:Ccdc110 UTSW 8 45935082 missense probably damaging 0.98
R0218:Ccdc110 UTSW 8 45934724 splice site probably benign
R0280:Ccdc110 UTSW 8 45943450 missense probably benign 0.03
R0332:Ccdc110 UTSW 8 45942964 nonsense probably null
R0371:Ccdc110 UTSW 8 45942806 missense possibly damaging 0.86
R0469:Ccdc110 UTSW 8 45935157 missense probably benign 0.00
R0502:Ccdc110 UTSW 8 45934724 splice site probably benign
R0510:Ccdc110 UTSW 8 45935157 missense probably benign 0.00
R0534:Ccdc110 UTSW 8 45935138 missense possibly damaging 0.73
R0647:Ccdc110 UTSW 8 45943388 missense probably damaging 0.99
R0714:Ccdc110 UTSW 8 45943010 missense possibly damaging 0.71
R0721:Ccdc110 UTSW 8 45941989 missense probably benign
R1029:Ccdc110 UTSW 8 45941780 missense probably damaging 0.98
R1147:Ccdc110 UTSW 8 45944084 missense possibly damaging 0.64
R1147:Ccdc110 UTSW 8 45944084 missense possibly damaging 0.64
R1170:Ccdc110 UTSW 8 45941885 missense probably benign 0.22
R1340:Ccdc110 UTSW 8 45942181 missense probably benign 0.02
R1540:Ccdc110 UTSW 8 45942325 nonsense probably null
R1587:Ccdc110 UTSW 8 45941746 missense probably benign 0.01
R1629:Ccdc110 UTSW 8 45942127 missense probably benign 0.08
R1842:Ccdc110 UTSW 8 45940568 missense probably damaging 1.00
R1933:Ccdc110 UTSW 8 45943250 missense probably damaging 1.00
R1934:Ccdc110 UTSW 8 45943250 missense probably damaging 1.00
R2006:Ccdc110 UTSW 8 45943312 missense probably damaging 1.00
R2043:Ccdc110 UTSW 8 45942827 missense probably benign 0.10
R2093:Ccdc110 UTSW 8 45942077 missense probably damaging 1.00
R2165:Ccdc110 UTSW 8 45942839 missense probably benign 0.00
R3613:Ccdc110 UTSW 8 45942806 missense possibly damaging 0.86
R3923:Ccdc110 UTSW 8 45942389 missense probably damaging 1.00
R4648:Ccdc110 UTSW 8 45942668 missense possibly damaging 0.95
R4773:Ccdc110 UTSW 8 45943208 missense probably damaging 1.00
R4901:Ccdc110 UTSW 8 45943400 missense probably benign 0.35
R4911:Ccdc110 UTSW 8 45942907 missense probably benign 0.00
R4923:Ccdc110 UTSW 8 45943423 missense probably benign 0.29
R5104:Ccdc110 UTSW 8 45942692 missense probably damaging 0.99
R5561:Ccdc110 UTSW 8 45940609 missense probably benign 0.02
R5966:Ccdc110 UTSW 8 45942536 missense probably damaging 1.00
R5976:Ccdc110 UTSW 8 45943499 missense possibly damaging 0.71
R6141:Ccdc110 UTSW 8 45941770 missense possibly damaging 0.89
R6326:Ccdc110 UTSW 8 45942041 missense probably damaging 1.00
R6366:Ccdc110 UTSW 8 45943388 missense probably damaging 0.99
R6405:Ccdc110 UTSW 8 45941697 nonsense probably null
R6482:Ccdc110 UTSW 8 45942788 missense probably benign 0.00
R6815:Ccdc110 UTSW 8 45941987 missense probably benign 0.19
R7387:Ccdc110 UTSW 8 45942196 missense probably benign 0.00
R7680:Ccdc110 UTSW 8 45941651 missense possibly damaging 0.64
R8099:Ccdc110 UTSW 8 45942093 missense probably damaging 1.00
R8114:Ccdc110 UTSW 8 45943103 missense probably damaging 1.00
R8151:Ccdc110 UTSW 8 45942793 missense probably damaging 1.00
X0053:Ccdc110 UTSW 8 45942961 missense possibly damaging 0.56
X0054:Ccdc110 UTSW 8 45941843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGTTTCAATGGAAGGATTGCCC -3'
(R):5'- ACAAACCCCAGTGTGGCTTGTTTC -3'

Sequencing Primer
(F):5'- ctctctctctctctctctctctctc -3'
(R):5'- GGCTTGTTTCCAAAAAGGATCAC -3'
Posted On2014-04-24