Incidental Mutation 'R1602:Pla2g12b'
ID176214
Institutional Source Beutler Lab
Gene Symbol Pla2g12b
Ensembl Gene ENSMUSG00000009646
Gene Namephospholipase A2, group XIIB
Synonyms2010002E04Rik, hlb218, Pla2g13
MMRRC Submission 039639-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R1602 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location59403660-59421976 bp(+) (GRCm38)
Type of Mutationunclassified (1405 bp from exon)
DNA Base Change (assembly) T to C at 59421553 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000009798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009790] [ENSMUST00000009798] [ENSMUST00000162643]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009790
AA Change: I186T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000009790
Gene: ENSMUSG00000009646
AA Change: I186T

DomainStartEndE-ValueType
Pfam:PLA2G12 12 195 1.5e-89 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000009798
SMART Domains Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:ZP 50 144 9e-24 BLAST
EGF 150 181 2.16e1 SMART
EGF 185 222 2.94e-3 SMART
EGF 226 263 2.35e-2 SMART
ZP 267 516 2.74e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162643
SMART Domains Protein: ENSMUSP00000123842
Gene: ENSMUSG00000009646

DomainStartEndE-ValueType
Pfam:PLA2G12 1 77 1.7e-36 PFAM
low complexity region 90 101 N/A INTRINSIC
Meta Mutation Damage Score 0.1127 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phospholipase A2 (PLA2) group of enzymes, which function in glycolipid hydrolysis with the release of free fatty acids and lysophospholipids. This family member has altered phospholipid-binding properties and is catalytically inactive. The protein is secreted, and together with microsomal triglyceride transfer protein, it functions to regulate HNF4alpha-induced hepatitis C virus infectivity. The expression of this gene is down-regulated in various tumors, suggesting that it may function as a negative regulator of tumor progression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit a reduction in serum total and HDL cholesterol levels, decreased serum triglyceride levels, and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 A T 17: 65,983,688 Y1583* probably null Het
Ankrd34c T C 9: 89,729,005 T428A possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Atr T C 9: 95,951,557 L2620P probably damaging Het
Ccdc110 A G 8: 45,938,918 Y54C probably benign Het
Cecr2 T C 6: 120,755,587 V480A possibly damaging Het
Chfr A G 5: 110,151,665 D308G probably benign Het
Cit T A 5: 115,997,730 I1919N probably damaging Het
Ctsc T A 7: 88,278,304 D34E possibly damaging Het
Diaph3 T A 14: 87,091,158 probably benign Het
Dnah6 T A 6: 73,067,469 I3220F probably damaging Het
Elmod3 A G 6: 72,569,259 probably null Het
Fam35a A G 14: 34,267,650 I433T probably damaging Het
Fgd5 T C 6: 92,066,184 V1215A possibly damaging Het
Filip1 T C 9: 79,820,591 M249V probably damaging Het
Fmn1 C T 2: 113,525,623 P803L unknown Het
Gcfc2 A G 6: 81,944,420 K469R probably damaging Het
Gm12169 T C 11: 46,535,588 I174T probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Gm8994 G A 6: 136,328,780 A80T probably damaging Het
Itgad A G 7: 128,190,939 T637A probably damaging Het
Kank2 T C 9: 21,769,837 S799G probably damaging Het
Kcnc4 A T 3: 107,448,204 D309E possibly damaging Het
Lamc2 G A 1: 153,127,028 T1069M probably benign Het
Lepr T A 4: 101,745,645 M210K possibly damaging Het
Lig3 T C 11: 82,792,194 probably null Het
Oat G T 7: 132,570,007 T33K probably benign Het
Olfr1356 T A 10: 78,846,968 M316L probably benign Het
Olfr1368 T C 13: 21,142,650 M136V probably damaging Het
Olfr32 A G 2: 90,139,055 F28S probably damaging Het
Pcnx3 G T 19: 5,672,515 A1383E probably damaging Het
Pctp T C 11: 89,988,735 Y100C probably damaging Het
Pex6 G T 17: 46,712,137 R213L probably benign Het
Phlpp2 T C 8: 109,934,023 L770S possibly damaging Het
Pkn2 A T 3: 142,853,538 D75E possibly damaging Het
Plch2 C T 4: 154,984,450 V1135I probably damaging Het
Pskh1 T A 8: 105,912,821 S44R probably benign Het
Ptpa G T 2: 30,437,590 A119S probably benign Het
Slfn3 A G 11: 83,212,715 I137M probably damaging Het
St6galnac1 A T 11: 116,769,287 S67T probably benign Het
Treml1 A G 17: 48,364,889 E137G probably damaging Het
Ubr2 A C 17: 46,941,061 C1518G probably benign Het
Vmn2r55 A T 7: 12,652,644 C470S probably damaging Het
Other mutations in Pla2g12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Pla2g12b APN 10 59416417 missense probably benign 0.28
IGL02526:Pla2g12b APN 10 59416453 missense probably damaging 1.00
IGL02551:Pla2g12b APN 10 59403870 missense probably damaging 1.00
florissant UTSW 10 59421441 unclassified probably benign
R0800:Pla2g12b UTSW 10 59403820 missense probably benign 0.00
R0918:Pla2g12b UTSW 10 59421484 missense probably damaging 0.98
R1412:Pla2g12b UTSW 10 59403982 critical splice donor site probably null
R3765:Pla2g12b UTSW 10 59421501 missense probably damaging 1.00
R4822:Pla2g12b UTSW 10 59416514 critical splice donor site probably null
R5963:Pla2g12b UTSW 10 59403958 missense probably damaging 1.00
R6140:Pla2g12b UTSW 10 59421441 unclassified probably benign
R7897:Pla2g12b UTSW 10 59410994 nonsense probably null
R7972:Pla2g12b UTSW 10 59421240 intron probably null
R7980:Pla2g12b UTSW 10 59410994 nonsense probably null
R8075:Pla2g12b UTSW 10 59421452 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTCATCACCCTGGAAATACCCTG -3'
(R):5'- TGTAGCGGTCCTTCAGCGAAGAAC -3'

Sequencing Primer
(F):5'- CTGGAAATACCCTGCCTCAC -3'
(R):5'- GAACTGAATTTCCAGGCACG -3'
Posted On2014-04-24