Incidental Mutation 'R1602:Lig3'
ID176218
Institutional Source Beutler Lab
Gene Symbol Lig3
Ensembl Gene ENSMUSG00000020697
Gene Nameligase III, DNA, ATP-dependent
SynonymsD11Wsu78e
MMRRC Submission 039639-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1602 (G1)
Quality Score205
Status Validated
Chromosome11
Chromosomal Location82781108-82804274 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 82792194 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021039] [ENSMUST00000021039] [ENSMUST00000021039] [ENSMUST00000021039] [ENSMUST00000021039] [ENSMUST00000021039] [ENSMUST00000080461] [ENSMUST00000080461] [ENSMUST00000080461] [ENSMUST00000080461] [ENSMUST00000080461] [ENSMUST00000080461] [ENSMUST00000092849] [ENSMUST00000092849] [ENSMUST00000092849] [ENSMUST00000131537] [ENSMUST00000173009] [ENSMUST00000173347] [ENSMUST00000173347] [ENSMUST00000173347] [ENSMUST00000173347] [ENSMUST00000173347] [ENSMUST00000173347] [ENSMUST00000173722] [ENSMUST00000173722] [ENSMUST00000173722] [ENSMUST00000173722] [ENSMUST00000173722] [ENSMUST00000173722] [ENSMUST00000173727] [ENSMUST00000173727] [ENSMUST00000173727] [ENSMUST00000173727] [ENSMUST00000173727] [ENSMUST00000173727]
Predicted Effect probably null
Transcript: ENSMUST00000021039
SMART Domains Protein: ENSMUSP00000021039
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 265 440 3.5e-34 PFAM
Pfam:DNA_ligase_A_M 489 683 3.9e-65 PFAM
Pfam:DNA_ligase_A_C 710 820 3.8e-21 PFAM
low complexity region 855 885 N/A INTRINSIC
BRCT 942 1010 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000021039
SMART Domains Protein: ENSMUSP00000021039
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 265 440 3.5e-34 PFAM
Pfam:DNA_ligase_A_M 489 683 3.9e-65 PFAM
Pfam:DNA_ligase_A_C 710 820 3.8e-21 PFAM
low complexity region 855 885 N/A INTRINSIC
BRCT 942 1010 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000021039
SMART Domains Protein: ENSMUSP00000021039
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 265 440 3.5e-34 PFAM
Pfam:DNA_ligase_A_M 489 683 3.9e-65 PFAM
Pfam:DNA_ligase_A_C 710 820 3.8e-21 PFAM
low complexity region 855 885 N/A INTRINSIC
BRCT 942 1010 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000021039
SMART Domains Protein: ENSMUSP00000021039
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 265 440 3.5e-34 PFAM
Pfam:DNA_ligase_A_M 489 683 3.9e-65 PFAM
Pfam:DNA_ligase_A_C 710 820 3.8e-21 PFAM
low complexity region 855 885 N/A INTRINSIC
BRCT 942 1010 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000021039
SMART Domains Protein: ENSMUSP00000021039
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 265 440 3.5e-34 PFAM
Pfam:DNA_ligase_A_M 489 683 3.9e-65 PFAM
Pfam:DNA_ligase_A_C 710 820 3.8e-21 PFAM
low complexity region 855 885 N/A INTRINSIC
BRCT 942 1010 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000021039
SMART Domains Protein: ENSMUSP00000021039
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 265 440 3.5e-34 PFAM
Pfam:DNA_ligase_A_M 489 683 3.9e-65 PFAM
Pfam:DNA_ligase_A_C 710 820 3.8e-21 PFAM
low complexity region 855 885 N/A INTRINSIC
BRCT 942 1010 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080461
SMART Domains Protein: ENSMUSP00000079317
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 6.8e-53 PFAM
Pfam:DNA_ligase_A_M 485 679 1.3e-63 PFAM
Pfam:DNA_ligase_A_C 706 816 3.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
low complexity region 934 946 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000080461
SMART Domains Protein: ENSMUSP00000079317
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 6.8e-53 PFAM
Pfam:DNA_ligase_A_M 485 679 1.3e-63 PFAM
Pfam:DNA_ligase_A_C 706 816 3.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
low complexity region 934 946 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000080461
SMART Domains Protein: ENSMUSP00000079317
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 6.8e-53 PFAM
Pfam:DNA_ligase_A_M 485 679 1.3e-63 PFAM
Pfam:DNA_ligase_A_C 706 816 3.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
low complexity region 934 946 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000080461
SMART Domains Protein: ENSMUSP00000079317
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 6.8e-53 PFAM
Pfam:DNA_ligase_A_M 485 679 1.3e-63 PFAM
Pfam:DNA_ligase_A_C 706 816 3.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
low complexity region 934 946 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000080461
SMART Domains Protein: ENSMUSP00000079317
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 6.8e-53 PFAM
Pfam:DNA_ligase_A_M 485 679 1.3e-63 PFAM
Pfam:DNA_ligase_A_C 706 816 3.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
low complexity region 934 946 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000080461
SMART Domains Protein: ENSMUSP00000079317
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 6.8e-53 PFAM
Pfam:DNA_ligase_A_M 485 679 1.3e-63 PFAM
Pfam:DNA_ligase_A_C 706 816 3.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
low complexity region 934 946 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092849
SMART Domains Protein: ENSMUSP00000090525
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000092849
SMART Domains Protein: ENSMUSP00000090525
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000092849
SMART Domains Protein: ENSMUSP00000090525
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131537
SMART Domains Protein: ENSMUSP00000133672
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 431 3.1e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172609
Predicted Effect probably benign
Transcript: ENSMUST00000173009
SMART Domains Protein: ENSMUSP00000133348
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 431 3.1e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173347
SMART Domains Protein: ENSMUSP00000134300
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173347
SMART Domains Protein: ENSMUSP00000134300
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173347
SMART Domains Protein: ENSMUSP00000134300
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173347
SMART Domains Protein: ENSMUSP00000134300
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173347
SMART Domains Protein: ENSMUSP00000134300
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173347
SMART Domains Protein: ENSMUSP00000134300
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173722
SMART Domains Protein: ENSMUSP00000133805
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173722
SMART Domains Protein: ENSMUSP00000133805
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173722
SMART Domains Protein: ENSMUSP00000133805
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173722
SMART Domains Protein: ENSMUSP00000133805
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173722
SMART Domains Protein: ENSMUSP00000133805
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173722
SMART Domains Protein: ENSMUSP00000133805
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173727
SMART Domains Protein: ENSMUSP00000133849
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173727
SMART Domains Protein: ENSMUSP00000133849
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173727
SMART Domains Protein: ENSMUSP00000133849
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173727
SMART Domains Protein: ENSMUSP00000133849
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173727
SMART Domains Protein: ENSMUSP00000133849
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173727
SMART Domains Protein: ENSMUSP00000133849
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA ligase family. Each member of this family encodes a protein that catalyzes the joining of DNA ends but they each have a distinct role in DNA metabolism. The protein encoded by this gene is involved in excision repair and is located in both the mitochondria and nucleus, with translation initiation from the upstream start codon allowing for transport to the mitochondria and translation initiation from a downstream start codon allowing for transport to the nucleus. Additionally, alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene causes embryonic growth arrest at 8.5 dpc, followed by excessive apoptosis at 9.5 dpc, and ultimately death, likely due to unrepaired DNA damage. Homozygous mutant cells display elevated sister chromatid exchange. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 A T 17: 65,983,688 Y1583* probably null Het
Ankrd34c T C 9: 89,729,005 T428A possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Atr T C 9: 95,951,557 L2620P probably damaging Het
Ccdc110 A G 8: 45,938,918 Y54C probably benign Het
Cecr2 T C 6: 120,755,587 V480A possibly damaging Het
Chfr A G 5: 110,151,665 D308G probably benign Het
Cit T A 5: 115,997,730 I1919N probably damaging Het
Ctsc T A 7: 88,278,304 D34E possibly damaging Het
Diaph3 T A 14: 87,091,158 probably benign Het
Dnah6 T A 6: 73,067,469 I3220F probably damaging Het
Elmod3 A G 6: 72,569,259 probably null Het
Fam35a A G 14: 34,267,650 I433T probably damaging Het
Fgd5 T C 6: 92,066,184 V1215A possibly damaging Het
Filip1 T C 9: 79,820,591 M249V probably damaging Het
Fmn1 C T 2: 113,525,623 P803L unknown Het
Gcfc2 A G 6: 81,944,420 K469R probably damaging Het
Gm12169 T C 11: 46,535,588 I174T probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Gm8994 G A 6: 136,328,780 A80T probably damaging Het
Itgad A G 7: 128,190,939 T637A probably damaging Het
Kank2 T C 9: 21,769,837 S799G probably damaging Het
Kcnc4 A T 3: 107,448,204 D309E possibly damaging Het
Lamc2 G A 1: 153,127,028 T1069M probably benign Het
Lepr T A 4: 101,745,645 M210K possibly damaging Het
Oat G T 7: 132,570,007 T33K probably benign Het
Olfr1356 T A 10: 78,846,968 M316L probably benign Het
Olfr1368 T C 13: 21,142,650 M136V probably damaging Het
Olfr32 A G 2: 90,139,055 F28S probably damaging Het
Pcnx3 G T 19: 5,672,515 A1383E probably damaging Het
Pctp T C 11: 89,988,735 Y100C probably damaging Het
Pex6 G T 17: 46,712,137 R213L probably benign Het
Phlpp2 T C 8: 109,934,023 L770S possibly damaging Het
Pkn2 A T 3: 142,853,538 D75E possibly damaging Het
Pla2g12b T C 10: 59,421,553 probably null Het
Plch2 C T 4: 154,984,450 V1135I probably damaging Het
Pskh1 T A 8: 105,912,821 S44R probably benign Het
Ptpa G T 2: 30,437,590 A119S probably benign Het
Slfn3 A G 11: 83,212,715 I137M probably damaging Het
St6galnac1 A T 11: 116,769,287 S67T probably benign Het
Treml1 A G 17: 48,364,889 E137G probably damaging Het
Ubr2 A C 17: 46,941,061 C1518G probably benign Het
Vmn2r55 A T 7: 12,652,644 C470S probably damaging Het
Other mutations in Lig3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Lig3 APN 11 82797315 missense possibly damaging 0.90
IGL01577:Lig3 APN 11 82783477 missense probably benign 0.00
IGL01643:Lig3 APN 11 82798292 missense probably damaging 1.00
IGL01712:Lig3 APN 11 82789541 splice site probably benign
IGL01724:Lig3 APN 11 82790622 missense possibly damaging 0.95
IGL01749:Lig3 APN 11 82789867 missense probably damaging 1.00
IGL01778:Lig3 APN 11 82794541 missense probably damaging 1.00
IGL02798:Lig3 APN 11 82795705 splice site probably benign
IGL03007:Lig3 APN 11 82789575 missense probably damaging 1.00
IGL03178:Lig3 APN 11 82789722 splice site probably benign
R0001:Lig3 UTSW 11 82790591 missense probably damaging 1.00
R0115:Lig3 UTSW 11 82793935 missense probably damaging 1.00
R0834:Lig3 UTSW 11 82798287 missense probably damaging 0.99
R1460:Lig3 UTSW 11 82795798 splice site probably benign
R1969:Lig3 UTSW 11 82795718 missense probably benign 0.14
R1971:Lig3 UTSW 11 82795718 missense probably benign 0.14
R1997:Lig3 UTSW 11 82787666 missense probably benign 0.00
R3817:Lig3 UTSW 11 82796115 missense possibly damaging 0.75
R4083:Lig3 UTSW 11 82790494 missense probably benign 0.31
R4084:Lig3 UTSW 11 82795424 missense probably damaging 1.00
R4665:Lig3 UTSW 11 82800250 missense probably damaging 0.99
R4737:Lig3 UTSW 11 82787727 missense probably damaging 1.00
R5212:Lig3 UTSW 11 82787678 missense probably benign
R5274:Lig3 UTSW 11 82797292 splice site probably null
R6320:Lig3 UTSW 11 82794007 critical splice donor site probably null
R6807:Lig3 UTSW 11 82783751 missense probably benign 0.00
R7103:Lig3 UTSW 11 82797312 missense probably benign 0.17
R7552:Lig3 UTSW 11 82788891 missense probably benign 0.00
R7646:Lig3 UTSW 11 82783478 missense probably benign 0.00
R7910:Lig3 UTSW 11 82797775 missense probably damaging 0.99
R7991:Lig3 UTSW 11 82797775 missense probably damaging 0.99
R8001:Lig3 UTSW 11 82792076 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AACCCAGTTCTGTCCTGACAGTCC -3'
(R):5'- TCCCAGCTAAGCAGCCTTTCATTAC -3'

Sequencing Primer
(F):5'- CCTGCTGTTGAAGGCAAATG -3'
(R):5'- GCCTTTCATTACTAGAAGAGTGCAG -3'
Posted On2014-04-24