Mutagenetix > Incidental Mutation

Incidental Mutation 'R1602:Slfn3'

176219

Institutional Source

Beutler Lab

Gene Symbol

Slfn3

Ensembl Gene

ENSMUSG00000018986

Gene Name

schlafen 3

Synonyms

MMRRC Submission

039639-MU

Accession Numbers

MGI: 1329005

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1602 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83191330-83215154 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83212715 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 137 (I137M)

Ref Sequence

ENSEMBL: ENSMUSP00000150425 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019130] [ENSMUST00000214041]

AlphaFold

A0A1L1STQ7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000019130
AA Change: I14M

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000019130
Gene: ENSMUSG00000018986
AA Change: I14M

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	165	303	5.5e-11	PFAM
low complexity region	394	412	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000214041
AA Change: I137M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216599

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.4%

Validation Efficiency

91% (49/54)

MGI Phenotype

PHENOTYPE: Mice homozygous for a targeted allele exhibit normal immune cell populations. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd12	A	T	17: 65,983,688	Y1583*	probably null	Het
Ankrd34c	T	C	9: 89,729,005	T428A	possibly damaging	Het
Arfgef1	G	C	1: 10,204,890	I312M	probably benign	Het
Atr	T	C	9: 95,951,557	L2620P	probably damaging	Het
Ccdc110	A	G	8: 45,938,918	Y54C	probably benign	Het
Cecr2	T	C	6: 120,755,587	V480A	possibly damaging	Het
Chfr	A	G	5: 110,151,665	D308G	probably benign	Het
Cit	T	A	5: 115,997,730	I1919N	probably damaging	Het
Ctsc	T	A	7: 88,278,304	D34E	possibly damaging	Het
Diaph3	T	A	14: 87,091,158		probably benign	Het
Dnah6	T	A	6: 73,067,469	I3220F	probably damaging	Het
Elmod3	A	G	6: 72,569,259		probably null	Het
Fam35a	A	G	14: 34,267,650	I433T	probably damaging	Het
Fgd5	T	C	6: 92,066,184	V1215A	possibly damaging	Het
Filip1	T	C	9: 79,820,591	M249V	probably damaging	Het
Fmn1	C	T	2: 113,525,623	P803L	unknown	Het
Gcfc2	A	G	6: 81,944,420	K469R	probably damaging	Het
Gm12169	T	C	11: 46,535,588	I174T	probably benign	Het
Gm6803	C	A	12: 88,018,364	E136D	probably benign	Het
Gm8994	G	A	6: 136,328,780	A80T	probably damaging	Het
Itgad	A	G	7: 128,190,939	T637A	probably damaging	Het
Kank2	T	C	9: 21,769,837	S799G	probably damaging	Het
Kcnc4	A	T	3: 107,448,204	D309E	possibly damaging	Het
Lamc2	G	A	1: 153,127,028	T1069M	probably benign	Het
Lepr	T	A	4: 101,745,645	M210K	possibly damaging	Het
Lig3	T	C	11: 82,792,194		probably null	Het
Oat	G	T	7: 132,570,007	T33K	probably benign	Het
Olfr1356	T	A	10: 78,846,968	M316L	probably benign	Het
Olfr1368	T	C	13: 21,142,650	M136V	probably damaging	Het
Olfr32	A	G	2: 90,139,055	F28S	probably damaging	Het
Pcnx3	G	T	19: 5,672,515	A1383E	probably damaging	Het
Pctp	T	C	11: 89,988,735	Y100C	probably damaging	Het
Pex6	G	T	17: 46,712,137	R213L	probably benign	Het
Phlpp2	T	C	8: 109,934,023	L770S	possibly damaging	Het
Pkn2	A	T	3: 142,853,538	D75E	possibly damaging	Het
Pla2g12b	T	C	10: 59,421,553		probably null	Het
Plch2	C	T	4: 154,984,450	V1135I	probably damaging	Het
Pskh1	T	A	8: 105,912,821	S44R	probably benign	Het
Ptpa	G	T	2: 30,437,590	A119S	probably benign	Het
St6galnac1	A	T	11: 116,769,287	S67T	probably benign	Het
Treml1	A	G	17: 48,364,889	E137G	probably damaging	Het
Ubr2	A	C	17: 46,941,061	C1518G	probably benign	Het
Vmn2r55	A	T	7: 12,652,644	C470S	probably damaging	Het

Other mutations in Slfn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00843:Slfn3	APN	11	83213431	missense	probably damaging	1.00
IGL01405:Slfn3	APN	11	83214716	missense	possibly damaging	0.90
IGL01631:Slfn3	APN	11	83213535	missense	probably damaging	0.99
IGL01944:Slfn3	APN	11	83213148	missense	possibly damaging	0.59
IGL02354:Slfn3	APN	11	83213242	missense	possibly damaging	0.95
IGL02361:Slfn3	APN	11	83213242	missense	possibly damaging	0.95
IGL02512:Slfn3	APN	11	83213025	missense	possibly damaging	0.55
IGL02875:Slfn3	APN	11	83213427	missense	probably damaging	0.98
IGL02944:Slfn3	APN	11	83213011	missense	probably damaging	0.99
IGL03402:Slfn3	APN	11	83213431	missense	probably damaging	1.00
R0452:Slfn3	UTSW	11	83213128	missense	possibly damaging	0.87
R0506:Slfn3	UTSW	11	83213160	missense	probably damaging	0.99
R0560:Slfn3	UTSW	11	83213152	missense	probably damaging	0.99
R0788:Slfn3	UTSW	11	83212836	missense	possibly damaging	0.47
R1713:Slfn3	UTSW	11	83213314	missense	probably damaging	0.98
R1881:Slfn3	UTSW	11	83213376	missense	possibly damaging	0.80
R2264:Slfn3	UTSW	11	83212972	missense	probably benign	0.00
R2441:Slfn3	UTSW	11	83212683	missense	probably benign	0.00
R2921:Slfn3	UTSW	11	83215045	missense	probably benign	0.01
R4163:Slfn3	UTSW	11	83212770	missense	probably damaging	1.00
R5099:Slfn3	UTSW	11	83214938	missense	probably damaging	0.98
R5448:Slfn3	UTSW	11	83214605	missense	probably damaging	0.99
R6441:Slfn3	UTSW	11	83214914	missense	probably benign	0.00
R6527:Slfn3	UTSW	11	83213106	missense	probably benign	0.01
R6785:Slfn3	UTSW	11	83214601	missense	possibly damaging	0.73
R7128:Slfn3	UTSW	11	83214895	missense	probably benign	0.00
R7344:Slfn3	UTSW	11	83212822	missense	probably benign	0.28
R7528:Slfn3	UTSW	11	83214905	missense	probably benign	0.01
R7763:Slfn3	UTSW	11	83214788	missense	possibly damaging	0.95
R8155:Slfn3	UTSW	11	83212785	missense	probably damaging	1.00
R8178:Slfn3	UTSW	11	83214679	missense	probably benign	0.33
R8210:Slfn3	UTSW	11	83214506	missense	possibly damaging	0.48
R8347:Slfn3	UTSW	11	83213589	missense	possibly damaging	0.95
R8671:Slfn3	UTSW	11	83212999	missense	probably benign	0.00
R9093:Slfn3	UTSW	11	83213122	missense	probably damaging	0.99
R9106:Slfn3	UTSW	11	83212632	missense	probably benign	0.00
R9293:Slfn3	UTSW	11	83214790	missense	possibly damaging	0.85
R9362:Slfn3	UTSW	11	83212981	missense	probably benign
R9521:Slfn3	UTSW	11	83212999	missense	probably benign
R9522:Slfn3	UTSW	11	83212999	missense	probably benign
R9644:Slfn3	UTSW	11	83214902	missense	probably damaging	1.00
Z1176:Slfn3	UTSW	11	83213409	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGACTTCATCTGGGAAACAGAGGC -3'
(R):5'- TTGAGGAGCTGCACTGCATTCG -3'

Sequencing Primer
(F):5'- GCAGTGATTGGAAAACAAACATC -3'
(R):5'- TTTCAAGGTGGTGATCCCC -3'

Posted On

2014-04-24