Incidental Mutation 'R1602:Slfn3'
ID176219
Institutional Source Beutler Lab
Gene Symbol Slfn3
Ensembl Gene ENSMUSG00000018986
Gene Nameschlafen 3
Synonyms
MMRRC Submission 039639-MU
Accession Numbers

MGI: 1329005

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1602 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83191330-83215154 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83212715 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 137 (I137M)
Ref Sequence ENSEMBL: ENSMUSP00000150425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019130] [ENSMUST00000214041]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019130
AA Change: I14M

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019130
Gene: ENSMUSG00000018986
AA Change: I14M

DomainStartEndE-ValueType
Pfam:AlbA_2 165 303 5.5e-11 PFAM
low complexity region 394 412 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214041
AA Change: I137M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216599
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 91% (49/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal immune cell populations. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 A T 17: 65,983,688 Y1583* probably null Het
Ankrd34c T C 9: 89,729,005 T428A possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Atr T C 9: 95,951,557 L2620P probably damaging Het
Ccdc110 A G 8: 45,938,918 Y54C probably benign Het
Cecr2 T C 6: 120,755,587 V480A possibly damaging Het
Chfr A G 5: 110,151,665 D308G probably benign Het
Cit T A 5: 115,997,730 I1919N probably damaging Het
Ctsc T A 7: 88,278,304 D34E possibly damaging Het
Diaph3 T A 14: 87,091,158 probably benign Het
Dnah6 T A 6: 73,067,469 I3220F probably damaging Het
Elmod3 A G 6: 72,569,259 probably null Het
Fam35a A G 14: 34,267,650 I433T probably damaging Het
Fgd5 T C 6: 92,066,184 V1215A possibly damaging Het
Filip1 T C 9: 79,820,591 M249V probably damaging Het
Fmn1 C T 2: 113,525,623 P803L unknown Het
Gcfc2 A G 6: 81,944,420 K469R probably damaging Het
Gm12169 T C 11: 46,535,588 I174T probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Gm8994 G A 6: 136,328,780 A80T probably damaging Het
Itgad A G 7: 128,190,939 T637A probably damaging Het
Kank2 T C 9: 21,769,837 S799G probably damaging Het
Kcnc4 A T 3: 107,448,204 D309E possibly damaging Het
Lamc2 G A 1: 153,127,028 T1069M probably benign Het
Lepr T A 4: 101,745,645 M210K possibly damaging Het
Lig3 T C 11: 82,792,194 probably null Het
Oat G T 7: 132,570,007 T33K probably benign Het
Olfr1356 T A 10: 78,846,968 M316L probably benign Het
Olfr1368 T C 13: 21,142,650 M136V probably damaging Het
Olfr32 A G 2: 90,139,055 F28S probably damaging Het
Pcnx3 G T 19: 5,672,515 A1383E probably damaging Het
Pctp T C 11: 89,988,735 Y100C probably damaging Het
Pex6 G T 17: 46,712,137 R213L probably benign Het
Phlpp2 T C 8: 109,934,023 L770S possibly damaging Het
Pkn2 A T 3: 142,853,538 D75E possibly damaging Het
Pla2g12b T C 10: 59,421,553 probably null Het
Plch2 C T 4: 154,984,450 V1135I probably damaging Het
Pskh1 T A 8: 105,912,821 S44R probably benign Het
Ptpa G T 2: 30,437,590 A119S probably benign Het
St6galnac1 A T 11: 116,769,287 S67T probably benign Het
Treml1 A G 17: 48,364,889 E137G probably damaging Het
Ubr2 A C 17: 46,941,061 C1518G probably benign Het
Vmn2r55 A T 7: 12,652,644 C470S probably damaging Het
Other mutations in Slfn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Slfn3 APN 11 83213431 missense probably damaging 1.00
IGL01405:Slfn3 APN 11 83214716 missense possibly damaging 0.90
IGL01631:Slfn3 APN 11 83213535 missense probably damaging 0.99
IGL01944:Slfn3 APN 11 83213148 missense possibly damaging 0.59
IGL02354:Slfn3 APN 11 83213242 missense possibly damaging 0.95
IGL02361:Slfn3 APN 11 83213242 missense possibly damaging 0.95
IGL02512:Slfn3 APN 11 83213025 missense possibly damaging 0.55
IGL02875:Slfn3 APN 11 83213427 missense probably damaging 0.98
IGL02944:Slfn3 APN 11 83213011 missense probably damaging 0.99
IGL03402:Slfn3 APN 11 83213431 missense probably damaging 1.00
R0452:Slfn3 UTSW 11 83213128 missense possibly damaging 0.87
R0506:Slfn3 UTSW 11 83213160 missense probably damaging 0.99
R0560:Slfn3 UTSW 11 83213152 missense probably damaging 0.99
R0788:Slfn3 UTSW 11 83212836 missense possibly damaging 0.47
R1713:Slfn3 UTSW 11 83213314 missense probably damaging 0.98
R1881:Slfn3 UTSW 11 83213376 missense possibly damaging 0.80
R2264:Slfn3 UTSW 11 83212972 missense probably benign 0.00
R2441:Slfn3 UTSW 11 83212683 missense probably benign 0.00
R2921:Slfn3 UTSW 11 83215045 missense probably benign 0.01
R4163:Slfn3 UTSW 11 83212770 missense probably damaging 1.00
R5099:Slfn3 UTSW 11 83214938 missense probably damaging 0.98
R5448:Slfn3 UTSW 11 83214605 missense probably damaging 0.99
R6441:Slfn3 UTSW 11 83214914 missense probably benign 0.00
R6527:Slfn3 UTSW 11 83213106 missense probably benign 0.01
R6785:Slfn3 UTSW 11 83214601 missense possibly damaging 0.73
R7128:Slfn3 UTSW 11 83214895 missense probably benign 0.00
R7344:Slfn3 UTSW 11 83212822 missense probably benign 0.28
R7528:Slfn3 UTSW 11 83214905 missense probably benign 0.01
R7763:Slfn3 UTSW 11 83214788 missense possibly damaging 0.95
R8155:Slfn3 UTSW 11 83212785 missense probably damaging 1.00
Z1176:Slfn3 UTSW 11 83213409 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACTTCATCTGGGAAACAGAGGC -3'
(R):5'- TTGAGGAGCTGCACTGCATTCG -3'

Sequencing Primer
(F):5'- GCAGTGATTGGAAAACAAACATC -3'
(R):5'- TTTCAAGGTGGTGATCCCC -3'
Posted On2014-04-24