Incidental Mutation 'R1602:St6galnac1'
ID176221
Institutional Source Beutler Lab
Gene Symbol St6galnac1
Ensembl Gene ENSMUSG00000009588
Gene NameST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
SynonymsSiat7a, ST6GalNAc I
MMRRC Submission 039639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1602 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116765025-116775507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116769287 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 67 (S67T)
Ref Sequence ENSEMBL: ENSMUSP00000009732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009732]
Predicted Effect probably benign
Transcript: ENSMUST00000009732
AA Change: S67T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000009732
Gene: ENSMUSG00000009588
AA Change: S67T

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_transf_29 230 518 2.9e-72 PFAM
Meta Mutation Damage Score 0.0858 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosylation of proteins affects cell-cell interaction, interactions with the matrix, and the functions of intracellular molecules. ST6GALNAC1 transfers a sialic acid, N-acetylneuraminic acid (NeuAc), in an alpha-2,6 linkage to O-linked GalNAc residues. The cancer-associated sialyl-Tn (sTn) antigen is formed by ST6GALNAC1-catalyzed sialylation of GalNAc residues on mucins (Ikehara et al., 1999 [PubMed 10536037]; Sewell et al., 2006 [PubMed 16319059]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 A T 17: 65,983,688 Y1583* probably null Het
Ankrd34c T C 9: 89,729,005 T428A possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Atr T C 9: 95,951,557 L2620P probably damaging Het
Ccdc110 A G 8: 45,938,918 Y54C probably benign Het
Cecr2 T C 6: 120,755,587 V480A possibly damaging Het
Chfr A G 5: 110,151,665 D308G probably benign Het
Cit T A 5: 115,997,730 I1919N probably damaging Het
Ctsc T A 7: 88,278,304 D34E possibly damaging Het
Diaph3 T A 14: 87,091,158 probably benign Het
Dnah6 T A 6: 73,067,469 I3220F probably damaging Het
Elmod3 A G 6: 72,569,259 probably null Het
Fam35a A G 14: 34,267,650 I433T probably damaging Het
Fgd5 T C 6: 92,066,184 V1215A possibly damaging Het
Filip1 T C 9: 79,820,591 M249V probably damaging Het
Fmn1 C T 2: 113,525,623 P803L unknown Het
Gcfc2 A G 6: 81,944,420 K469R probably damaging Het
Gm12169 T C 11: 46,535,588 I174T probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Gm8994 G A 6: 136,328,780 A80T probably damaging Het
Itgad A G 7: 128,190,939 T637A probably damaging Het
Kank2 T C 9: 21,769,837 S799G probably damaging Het
Kcnc4 A T 3: 107,448,204 D309E possibly damaging Het
Lamc2 G A 1: 153,127,028 T1069M probably benign Het
Lepr T A 4: 101,745,645 M210K possibly damaging Het
Lig3 T C 11: 82,792,194 probably null Het
Oat G T 7: 132,570,007 T33K probably benign Het
Olfr1356 T A 10: 78,846,968 M316L probably benign Het
Olfr1368 T C 13: 21,142,650 M136V probably damaging Het
Olfr32 A G 2: 90,139,055 F28S probably damaging Het
Pcnx3 G T 19: 5,672,515 A1383E probably damaging Het
Pctp T C 11: 89,988,735 Y100C probably damaging Het
Pex6 G T 17: 46,712,137 R213L probably benign Het
Phlpp2 T C 8: 109,934,023 L770S possibly damaging Het
Pkn2 A T 3: 142,853,538 D75E possibly damaging Het
Pla2g12b T C 10: 59,421,553 probably null Het
Plch2 C T 4: 154,984,450 V1135I probably damaging Het
Pskh1 T A 8: 105,912,821 S44R probably benign Het
Ptpa G T 2: 30,437,590 A119S probably benign Het
Slfn3 A G 11: 83,212,715 I137M probably damaging Het
Treml1 A G 17: 48,364,889 E137G probably damaging Het
Ubr2 A C 17: 46,941,061 C1518G probably benign Het
Vmn2r55 A T 7: 12,652,644 C470S probably damaging Het
Other mutations in St6galnac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:St6galnac1 APN 11 116767706 missense probably damaging 1.00
IGL01451:St6galnac1 APN 11 116769339 missense probably benign 0.00
IGL01873:St6galnac1 APN 11 116766611 missense probably damaging 0.98
IGL02569:St6galnac1 APN 11 116767702 missense probably damaging 1.00
IGL02799:St6galnac1 APN 11 116766647 splice site probably benign
IGL02935:St6galnac1 APN 11 116769345 missense probably benign
IGL03124:St6galnac1 APN 11 116775299 missense probably benign 0.00
PIT4520001:St6galnac1 UTSW 11 116769349 missense probably benign 0.00
R0126:St6galnac1 UTSW 11 116766584 missense probably benign 0.00
R0363:St6galnac1 UTSW 11 116768930 missense probably benign 0.36
R0394:St6galnac1 UTSW 11 116766640 missense probably damaging 0.99
R0828:St6galnac1 UTSW 11 116768997 missense probably benign 0.05
R1569:St6galnac1 UTSW 11 116769271 missense possibly damaging 0.46
R1570:St6galnac1 UTSW 11 116766648 splice site probably benign
R1591:St6galnac1 UTSW 11 116765863 missense probably damaging 1.00
R2088:St6galnac1 UTSW 11 116769107 missense probably benign 0.00
R2212:St6galnac1 UTSW 11 116765856 missense probably damaging 1.00
R2266:St6galnac1 UTSW 11 116767847 nonsense probably null
R3413:St6galnac1 UTSW 11 116765856 missense probably damaging 1.00
R3835:St6galnac1 UTSW 11 116766283 missense probably damaging 1.00
R5016:St6galnac1 UTSW 11 116765880 missense probably damaging 1.00
R5446:St6galnac1 UTSW 11 116766269 missense probably benign 0.37
R6625:St6galnac1 UTSW 11 116765891 missense probably damaging 1.00
R6805:St6galnac1 UTSW 11 116768944 missense probably damaging 1.00
R7007:St6galnac1 UTSW 11 116767007 nonsense probably null
R7133:St6galnac1 UTSW 11 116767073 missense possibly damaging 0.89
R7491:St6galnac1 UTSW 11 116769184 missense probably benign 0.14
R7724:St6galnac1 UTSW 11 116766072 critical splice donor site probably null
R7812:St6galnac1 UTSW 11 116769101 missense probably benign 0.16
Z1177:St6galnac1 UTSW 11 116775428 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGTTTGTCCAGGTGTTCTGACACAG -3'
(R):5'- GCAACAAGCCAGGATCATGAGACTC -3'

Sequencing Primer
(F):5'- ATTCTCTGGTGCTGGCCTTA -3'
(R):5'- tggaggataaaacaggaaaacac -3'
Posted On2014-04-24