Incidental Mutation 'R1602:Diaph3'
ID176226
Institutional Source Beutler Lab
Gene Symbol Diaph3
Ensembl Gene ENSMUSG00000022021
Gene Namediaphanous related formin 3
Synonyms4930417P13Rik, Diap3, mDia2, p134MDia2, Drf3
MMRRC Submission 039639-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1602 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location86655367-87141235 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 87091158 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022599] [ENSMUST00000168889] [ENSMUST00000228000]
Predicted Effect probably benign
Transcript: ENSMUST00000022599
SMART Domains Protein: ENSMUSP00000022599
Gene: ENSMUSG00000022021

DomainStartEndE-ValueType
low complexity region 76 86 N/A INTRINSIC
Drf_GBD 93 276 7.94e-61 SMART
Drf_FH3 281 467 5.74e-67 SMART
coiled coil region 485 533 N/A INTRINSIC
SCOP:d1jvr__ 545 589 1e-3 SMART
FH2 615 1056 3.88e-180 SMART
Blast:FH2 1087 1160 2e-27 BLAST
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168889
SMART Domains Protein: ENSMUSP00000129420
Gene: ENSMUSG00000022021

DomainStartEndE-ValueType
low complexity region 76 86 N/A INTRINSIC
Drf_GBD 93 276 7.94e-61 SMART
Drf_FH3 281 467 5.74e-67 SMART
coiled coil region 485 533 N/A INTRINSIC
SCOP:d1jvr__ 545 589 1e-3 SMART
FH2 615 1056 3.2e-181 SMART
Blast:FH2 1087 1160 2e-27 BLAST
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227666
Predicted Effect probably benign
Transcript: ENSMUST00000228000
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in this gene are associated with autosomal dominant auditory neuropathy 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for disruption of this gene display embryonic mortality and abnormal cytokinesis of RBC. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 A T 17: 65,983,688 Y1583* probably null Het
Ankrd34c T C 9: 89,729,005 T428A possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Atr T C 9: 95,951,557 L2620P probably damaging Het
Ccdc110 A G 8: 45,938,918 Y54C probably benign Het
Cecr2 T C 6: 120,755,587 V480A possibly damaging Het
Chfr A G 5: 110,151,665 D308G probably benign Het
Cit T A 5: 115,997,730 I1919N probably damaging Het
Ctsc T A 7: 88,278,304 D34E possibly damaging Het
Dnah6 T A 6: 73,067,469 I3220F probably damaging Het
Elmod3 A G 6: 72,569,259 probably null Het
Fam35a A G 14: 34,267,650 I433T probably damaging Het
Fgd5 T C 6: 92,066,184 V1215A possibly damaging Het
Filip1 T C 9: 79,820,591 M249V probably damaging Het
Fmn1 C T 2: 113,525,623 P803L unknown Het
Gcfc2 A G 6: 81,944,420 K469R probably damaging Het
Gm12169 T C 11: 46,535,588 I174T probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Gm8994 G A 6: 136,328,780 A80T probably damaging Het
Itgad A G 7: 128,190,939 T637A probably damaging Het
Kank2 T C 9: 21,769,837 S799G probably damaging Het
Kcnc4 A T 3: 107,448,204 D309E possibly damaging Het
Lamc2 G A 1: 153,127,028 T1069M probably benign Het
Lepr T A 4: 101,745,645 M210K possibly damaging Het
Lig3 T C 11: 82,792,194 probably null Het
Oat G T 7: 132,570,007 T33K probably benign Het
Olfr1356 T A 10: 78,846,968 M316L probably benign Het
Olfr1368 T C 13: 21,142,650 M136V probably damaging Het
Olfr32 A G 2: 90,139,055 F28S probably damaging Het
Pcnx3 G T 19: 5,672,515 A1383E probably damaging Het
Pctp T C 11: 89,988,735 Y100C probably damaging Het
Pex6 G T 17: 46,712,137 R213L probably benign Het
Phlpp2 T C 8: 109,934,023 L770S possibly damaging Het
Pkn2 A T 3: 142,853,538 D75E possibly damaging Het
Pla2g12b T C 10: 59,421,553 probably null Het
Plch2 C T 4: 154,984,450 V1135I probably damaging Het
Pskh1 T A 8: 105,912,821 S44R probably benign Het
Ptpa G T 2: 30,437,590 A119S probably benign Het
Slfn3 A G 11: 83,212,715 I137M probably damaging Het
St6galnac1 A T 11: 116,769,287 S67T probably benign Het
Treml1 A G 17: 48,364,889 E137G probably damaging Het
Ubr2 A C 17: 46,941,061 C1518G probably benign Het
Vmn2r55 A T 7: 12,652,644 C470S probably damaging Het
Other mutations in Diaph3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Diaph3 APN 14 87002871 missense probably benign
IGL00809:Diaph3 APN 14 87000027 missense probably damaging 0.98
IGL01419:Diaph3 APN 14 86965553 nonsense probably null
IGL01577:Diaph3 APN 14 86906031 missense probably damaging 0.99
IGL01718:Diaph3 APN 14 86656338 missense unknown
IGL01736:Diaph3 APN 14 86918846 missense probably benign 0.01
IGL01893:Diaph3 APN 14 86918852 missense possibly damaging 0.71
IGL02316:Diaph3 APN 14 86986115 missense possibly damaging 0.88
IGL02527:Diaph3 APN 14 86810359 missense possibly damaging 0.47
IGL02586:Diaph3 APN 14 86986076 nonsense probably null
IGL02749:Diaph3 APN 14 86918825 missense probably damaging 0.99
IGL02892:Diaph3 APN 14 86866630 nonsense probably null
IGL03069:Diaph3 APN 14 86772119 missense probably damaging 1.00
IGL03191:Diaph3 APN 14 87073302 missense possibly damaging 0.75
R0007:Diaph3 UTSW 14 86866620 missense possibly damaging 0.86
R0007:Diaph3 UTSW 14 86866620 missense possibly damaging 0.86
R0011:Diaph3 UTSW 14 86866408 missense probably damaging 1.00
R0051:Diaph3 UTSW 14 87037454 critical splice donor site probably null
R0051:Diaph3 UTSW 14 87037454 critical splice donor site probably null
R0285:Diaph3 UTSW 14 87115024 missense possibly damaging 0.86
R0359:Diaph3 UTSW 14 86969502 missense probably benign 0.26
R0505:Diaph3 UTSW 14 87090964 splice site probably benign
R0551:Diaph3 UTSW 14 86910100 missense probably benign 0.45
R1295:Diaph3 UTSW 14 87007399 missense probably damaging 1.00
R1539:Diaph3 UTSW 14 86656480 missense probably damaging 1.00
R1725:Diaph3 UTSW 14 86966323 critical splice donor site probably null
R1745:Diaph3 UTSW 14 86966560 missense probably damaging 0.96
R1747:Diaph3 UTSW 14 87073337 missense probably damaging 0.98
R1772:Diaph3 UTSW 14 86965549 missense probably damaging 1.00
R1914:Diaph3 UTSW 14 86656485 missense probably damaging 0.98
R1942:Diaph3 UTSW 14 87141120 utr 5 prime probably benign
R1999:Diaph3 UTSW 14 86984866 missense possibly damaging 0.53
R2291:Diaph3 UTSW 14 86966446 missense probably damaging 1.00
R2999:Diaph3 UTSW 14 86772094 missense probably damaging 0.99
R3158:Diaph3 UTSW 14 86656456 missense possibly damaging 0.84
R3612:Diaph3 UTSW 14 87037457 missense probably null 0.89
R4170:Diaph3 UTSW 14 86985707 missense probably damaging 1.00
R4594:Diaph3 UTSW 14 86986037 missense probably damaging 0.99
R4912:Diaph3 UTSW 14 87007199 missense probably damaging 1.00
R4930:Diaph3 UTSW 14 87141166 start gained probably benign
R5063:Diaph3 UTSW 14 86984870 missense probably damaging 1.00
R5093:Diaph3 UTSW 14 86984800 missense probably damaging 1.00
R5267:Diaph3 UTSW 14 86656553 missense probably benign 0.03
R5289:Diaph3 UTSW 14 86981678 missense probably damaging 1.00
R5549:Diaph3 UTSW 14 86978670 missense probably benign 0.14
R5936:Diaph3 UTSW 14 86772116 missense possibly damaging 0.53
R5966:Diaph3 UTSW 14 86984825 missense probably damaging 1.00
R6236:Diaph3 UTSW 14 87037568 nonsense probably null
R6323:Diaph3 UTSW 14 86966453 missense probably benign 0.03
R6331:Diaph3 UTSW 14 86866540 missense probably damaging 1.00
R6362:Diaph3 UTSW 14 86772130 missense probably damaging 1.00
R6398:Diaph3 UTSW 14 86866486 missense probably damaging 1.00
R6408:Diaph3 UTSW 14 86828994 missense possibly damaging 0.68
R6469:Diaph3 UTSW 14 86656538 missense possibly damaging 0.71
R6519:Diaph3 UTSW 14 86966335 missense probably damaging 1.00
R7261:Diaph3 UTSW 14 86965457 missense probably benign 0.04
R7283:Diaph3 UTSW 14 86866584 missense probably damaging 1.00
R7782:Diaph3 UTSW 14 87037504 missense probably benign 0.00
R7811:Diaph3 UTSW 14 86981624 missense probably damaging 1.00
R8012:Diaph3 UTSW 14 87037522 missense probably benign
R8024:Diaph3 UTSW 14 86656399 missense probably damaging 1.00
R8065:Diaph3 UTSW 14 87037495 missense probably damaging 1.00
Z1176:Diaph3 UTSW 14 86656432 missense probably benign 0.09
Z1177:Diaph3 UTSW 14 87002814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGACTTCACTCTCTGGCAGCG -3'
(R):5'- AGCTGACTTGCGTCTGTGAAACTG -3'

Sequencing Primer
(F):5'- CTCTGGCAGCGCCTTTG -3'
(R):5'- atgtaaaggcactggcaaac -3'
Posted On2014-04-24