Incidental Mutation 'R1602:Pex6'
ID176227
Institutional Source Beutler Lab
Gene Symbol Pex6
Ensembl Gene ENSMUSG00000002763
Gene Nameperoxisomal biogenesis factor 6
SynonymsD130055I09Rik
MMRRC Submission 039639-MU
Accession Numbers

Genbank: NM_145488; Ensembl: ENSMUSP00000002840

Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #R1602 (G1)
Quality Score141
Status Validated
Chromosome17
Chromosomal Location46711463-46725541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46712137 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 213 (R213L)
Ref Sequence ENSEMBL: ENSMUSP00000002840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002840]
Predicted Effect probably benign
Transcript: ENSMUST00000002840
AA Change: R213L

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000002840
Gene: ENSMUSG00000002763
AA Change: R213L

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 72 86 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 112 128 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
AAA 463 598 6.1e-7 SMART
AAA 737 875 6e-24 SMART
Blast:AAA 928 973 1e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.1346 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) family of ATPases. This member is a predominantly cytoplasmic protein, which plays a direct role in peroxisomal protein import and is required for PTS1 (peroxisomal targeting signal 1, a C-terminal tripeptide of the sequence ser-lys-leu) receptor activity. Mutations in this gene cause peroxisome biogenesis disorders of complementation group 4 and complementation group 6. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 A T 17: 65,983,688 Y1583* probably null Het
Ankrd34c T C 9: 89,729,005 T428A possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Atr T C 9: 95,951,557 L2620P probably damaging Het
Ccdc110 A G 8: 45,938,918 Y54C probably benign Het
Cecr2 T C 6: 120,755,587 V480A possibly damaging Het
Chfr A G 5: 110,151,665 D308G probably benign Het
Cit T A 5: 115,997,730 I1919N probably damaging Het
Ctsc T A 7: 88,278,304 D34E possibly damaging Het
Diaph3 T A 14: 87,091,158 probably benign Het
Dnah6 T A 6: 73,067,469 I3220F probably damaging Het
Elmod3 A G 6: 72,569,259 probably null Het
Fam35a A G 14: 34,267,650 I433T probably damaging Het
Fgd5 T C 6: 92,066,184 V1215A possibly damaging Het
Filip1 T C 9: 79,820,591 M249V probably damaging Het
Fmn1 C T 2: 113,525,623 P803L unknown Het
Gcfc2 A G 6: 81,944,420 K469R probably damaging Het
Gm12169 T C 11: 46,535,588 I174T probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Gm8994 G A 6: 136,328,780 A80T probably damaging Het
Itgad A G 7: 128,190,939 T637A probably damaging Het
Kank2 T C 9: 21,769,837 S799G probably damaging Het
Kcnc4 A T 3: 107,448,204 D309E possibly damaging Het
Lamc2 G A 1: 153,127,028 T1069M probably benign Het
Lepr T A 4: 101,745,645 M210K possibly damaging Het
Lig3 T C 11: 82,792,194 probably null Het
Oat G T 7: 132,570,007 T33K probably benign Het
Olfr1356 T A 10: 78,846,968 M316L probably benign Het
Olfr1368 T C 13: 21,142,650 M136V probably damaging Het
Olfr32 A G 2: 90,139,055 F28S probably damaging Het
Pcnx3 G T 19: 5,672,515 A1383E probably damaging Het
Pctp T C 11: 89,988,735 Y100C probably damaging Het
Phlpp2 T C 8: 109,934,023 L770S possibly damaging Het
Pkn2 A T 3: 142,853,538 D75E possibly damaging Het
Pla2g12b T C 10: 59,421,553 probably null Het
Plch2 C T 4: 154,984,450 V1135I probably damaging Het
Pskh1 T A 8: 105,912,821 S44R probably benign Het
Ptpa G T 2: 30,437,590 A119S probably benign Het
Slfn3 A G 11: 83,212,715 I137M probably damaging Het
St6galnac1 A T 11: 116,769,287 S67T probably benign Het
Treml1 A G 17: 48,364,889 E137G probably damaging Het
Ubr2 A C 17: 46,941,061 C1518G probably benign Het
Vmn2r55 A T 7: 12,652,644 C470S probably damaging Het
Other mutations in Pex6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Pex6 APN 17 46725304 missense probably benign 0.00
IGL01601:Pex6 APN 17 46723724 missense probably damaging 1.00
IGL01710:Pex6 APN 17 46725326 unclassified probably benign
IGL02392:Pex6 APN 17 46723499 missense probably damaging 1.00
IGL02419:Pex6 APN 17 46724435 missense possibly damaging 0.69
G5030:Pex6 UTSW 17 46715456 intron probably benign
R0091:Pex6 UTSW 17 46711918 missense probably damaging 1.00
R0243:Pex6 UTSW 17 46723737 critical splice donor site probably null
R0732:Pex6 UTSW 17 46724700 missense probably damaging 1.00
R1529:Pex6 UTSW 17 46714064 missense probably benign 0.10
R1638:Pex6 UTSW 17 46722632 missense probably benign
R1757:Pex6 UTSW 17 46723498 missense probably damaging 1.00
R3769:Pex6 UTSW 17 46724385 splice site probably null
R4684:Pex6 UTSW 17 46712101 missense probably benign 0.01
R4731:Pex6 UTSW 17 46722288 missense probably benign 0.02
R4731:Pex6 UTSW 17 46724707 splice site probably null
R4732:Pex6 UTSW 17 46724707 splice site probably null
R4732:Pex6 UTSW 17 46722288 missense probably benign 0.02
R4733:Pex6 UTSW 17 46722288 missense probably benign 0.02
R4733:Pex6 UTSW 17 46724707 splice site probably null
R4915:Pex6 UTSW 17 46714056 missense probably damaging 0.96
R5996:Pex6 UTSW 17 46714458 splice site probably null
R6156:Pex6 UTSW 17 46720641 missense probably benign 0.02
R6227:Pex6 UTSW 17 46712108 missense probably benign 0.00
R7054:Pex6 UTSW 17 46720521 missense probably benign
R7635:Pex6 UTSW 17 46724017 missense probably damaging 1.00
R8034:Pex6 UTSW 17 46722399 missense possibly damaging 0.67
R8177:Pex6 UTSW 17 46714062 missense probably benign
R8330:Pex6 UTSW 17 46712134 missense possibly damaging 0.55
R8348:Pex6 UTSW 17 46723113 missense probably benign
R8695:Pex6 UTSW 17 46712049 missense probably damaging 0.97
Z1088:Pex6 UTSW 17 46712222 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CCAAACTGGGCCAGGAGAGTCG -3'
(R):5'- AGGCACAGGGGACCTGAATTCTAC -3'

Sequencing Primer
(F):5'- AGTCGGGATCACAGCCATC -3'
(R):5'- GTTAAAGGAAGCATTCCTGACCTG -3'
Posted On2014-04-24