Incidental Mutation 'R1602:Treml1'
ID176229
Institutional Source Beutler Lab
Gene Symbol Treml1
Ensembl Gene ENSMUSG00000023993
Gene Nametriggering receptor expressed on myeloid cells-like 1
Synonyms5430401J17Rik, TLT-1
MMRRC Submission 039639-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1602 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location48359916-48367176 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48364889 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 137 (E137G)
Ref Sequence ENSEMBL: ENSMUSP00000153104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024792] [ENSMUST00000223956] [ENSMUST00000224001] [ENSMUST00000225849]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024792
AA Change: E137G

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024792
Gene: ENSMUSG00000023993
AA Change: E137G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 24 124 2.83e-3 SMART
transmembrane domain 179 201 N/A INTRINSIC
low complexity region 260 280 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000223956
AA Change: R61G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223968
Predicted Effect possibly damaging
Transcript: ENSMUST00000224001
AA Change: E137G

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000225849
AA Change: E137G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.1154 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the triggering receptor expressed on myeloid cells-like (TREM) family. The encoded protein is a type 1 single Ig domain orphan receptor localized to the alpha-granule membranes of platelets. The encoded protein is involved in platelet aggregation, inflammation, and cellular activation and has been linked to Gray platelet syndrome. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show a reduced platelet count, defective platelet aggregation, prolonged bleeding times, enhanced inflammatory hemorrhage, and increased susceptibility to death from endotoxin (LPS) challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 A T 17: 65,983,688 Y1583* probably null Het
Ankrd34c T C 9: 89,729,005 T428A possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Atr T C 9: 95,951,557 L2620P probably damaging Het
Ccdc110 A G 8: 45,938,918 Y54C probably benign Het
Cecr2 T C 6: 120,755,587 V480A possibly damaging Het
Chfr A G 5: 110,151,665 D308G probably benign Het
Cit T A 5: 115,997,730 I1919N probably damaging Het
Ctsc T A 7: 88,278,304 D34E possibly damaging Het
Diaph3 T A 14: 87,091,158 probably benign Het
Dnah6 T A 6: 73,067,469 I3220F probably damaging Het
Elmod3 A G 6: 72,569,259 probably null Het
Fam35a A G 14: 34,267,650 I433T probably damaging Het
Fgd5 T C 6: 92,066,184 V1215A possibly damaging Het
Filip1 T C 9: 79,820,591 M249V probably damaging Het
Fmn1 C T 2: 113,525,623 P803L unknown Het
Gcfc2 A G 6: 81,944,420 K469R probably damaging Het
Gm12169 T C 11: 46,535,588 I174T probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Gm8994 G A 6: 136,328,780 A80T probably damaging Het
Itgad A G 7: 128,190,939 T637A probably damaging Het
Kank2 T C 9: 21,769,837 S799G probably damaging Het
Kcnc4 A T 3: 107,448,204 D309E possibly damaging Het
Lamc2 G A 1: 153,127,028 T1069M probably benign Het
Lepr T A 4: 101,745,645 M210K possibly damaging Het
Lig3 T C 11: 82,792,194 probably null Het
Oat G T 7: 132,570,007 T33K probably benign Het
Olfr1356 T A 10: 78,846,968 M316L probably benign Het
Olfr1368 T C 13: 21,142,650 M136V probably damaging Het
Olfr32 A G 2: 90,139,055 F28S probably damaging Het
Pcnx3 G T 19: 5,672,515 A1383E probably damaging Het
Pctp T C 11: 89,988,735 Y100C probably damaging Het
Pex6 G T 17: 46,712,137 R213L probably benign Het
Phlpp2 T C 8: 109,934,023 L770S possibly damaging Het
Pkn2 A T 3: 142,853,538 D75E possibly damaging Het
Pla2g12b T C 10: 59,421,553 probably null Het
Plch2 C T 4: 154,984,450 V1135I probably damaging Het
Pskh1 T A 8: 105,912,821 S44R probably benign Het
Ptpa G T 2: 30,437,590 A119S probably benign Het
Slfn3 A G 11: 83,212,715 I137M probably damaging Het
St6galnac1 A T 11: 116,769,287 S67T probably benign Het
Ubr2 A C 17: 46,941,061 C1518G probably benign Het
Vmn2r55 A T 7: 12,652,644 C470S probably damaging Het
Other mutations in Treml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Treml1 APN 17 48365599 splice site probably benign
IGL01868:Treml1 APN 17 48366007 missense probably benign 0.41
IGL02543:Treml1 APN 17 48360431 missense possibly damaging 0.93
IGL03136:Treml1 APN 17 48364851 splice site probably benign
IGL03242:Treml1 APN 17 48365988 splice site probably benign
R0047:Treml1 UTSW 17 48364980 nonsense probably null
R0047:Treml1 UTSW 17 48364980 nonsense probably null
R0226:Treml1 UTSW 17 48360458 missense probably damaging 0.99
R1385:Treml1 UTSW 17 48360198 missense probably damaging 1.00
R4379:Treml1 UTSW 17 48360396 missense probably damaging 1.00
R4865:Treml1 UTSW 17 48366857 missense probably benign 0.00
R5837:Treml1 UTSW 17 48360152 missense possibly damaging 0.74
R7102:Treml1 UTSW 17 48366672 missense probably damaging 0.98
R7107:Treml1 UTSW 17 48360219 missense probably damaging 1.00
R7442:Treml1 UTSW 17 48366691 missense probably damaging 1.00
R7825:Treml1 UTSW 17 48366756 missense probably damaging 1.00
RF058:Treml1 UTSW 17 48359947 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAGACATACCAGTGTGTGGGATG -3'
(R):5'- TGCTGATGGGAAGGTCACTAGCAG -3'

Sequencing Primer
(F):5'- GGCTATGTTTACAACCAGACAG -3'
(R):5'- ccagagcaaaagcagcaag -3'
Posted On2014-04-24