Incidental Mutation 'R1603:Dlgap3'
ID176244
Institutional Source Beutler Lab
Gene Symbol Dlgap3
Ensembl Gene ENSMUSG00000042388
Gene NameDLG associated protein 3
SynonymsPSD-95/SAP90-binding protein 3, SAP90/PSD 95 associated protein 3, Sapap3, DAP3, Prpl8
MMRRC Submission 039640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R1603 (G1)
Quality Score213
Status Validated
Chromosome4
Chromosomal Location127169204-127237022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127195228 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 206 (G206R)
Ref Sequence ENSEMBL: ENSMUSP00000101700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046659] [ENSMUST00000106092] [ENSMUST00000106094]
Predicted Effect probably damaging
Transcript: ENSMUST00000046659
AA Change: G206R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039724
Gene: ENSMUSG00000042388
AA Change: G206R

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 6.49e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 6.49e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 619 977 1.3e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106092
AA Change: G206R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101698
Gene: ENSMUSG00000042388
AA Change: G206R

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 5.59e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 5.59e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 619 966 1.8e-127 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106094
AA Change: G206R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101700
Gene: ENSMUSG00000042388
AA Change: G206R

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 6.49e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 6.49e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 626 977 1.3e-149 PFAM
Meta Mutation Damage Score 0.1365 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 96% (65/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit skin lesions associated with excessive grooming, increased anxiety-related behaviors, altered synaptic transmission and abnormal sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4931408C20Rik T A 1: 26,685,569 R177W probably damaging Het
Ace T A 11: 105,972,099 S315R probably benign Het
Adamtsl1 A G 4: 86,415,530 I1491V probably benign Het
Adrb2 A T 18: 62,179,508 M82K probably damaging Het
Aebp2 A G 6: 140,642,253 N350D probably damaging Het
Ankrd42 T C 7: 92,619,691 probably benign Het
Asap1 A T 15: 64,129,257 C492S probably damaging Het
Atp8b3 C A 10: 80,525,785 A768S probably benign Het
Chga T A 12: 102,564,607 probably null Het
Clca4b A G 3: 144,922,019 V397A probably benign Het
Cntnap5a A C 1: 116,412,101 T697P possibly damaging Het
Col12a1 T C 9: 79,612,962 Q2810R probably damaging Het
Dchs1 G T 7: 105,762,770 R1380S probably benign Het
Dgkg T A 16: 22,570,159 probably benign Het
Dnah5 A G 15: 28,294,985 probably benign Het
Dnah5 A T 15: 28,449,180 I4243L probably benign Het
Fbxw22 G T 9: 109,378,847 P452H probably benign Het
Fgl1 T A 8: 41,197,018 D242V probably damaging Het
Gba2 C T 4: 43,567,823 G794R probably damaging Het
Gimap7 A T 6: 48,723,930 D150V probably damaging Het
Gm5334 T C 7: 68,618,872 V13A probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Grk5 T C 19: 61,069,362 F167L probably benign Het
Ice1 A G 13: 70,603,353 L1538P probably benign Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Kmt2a A T 9: 44,841,561 probably null Het
Kras A T 6: 145,225,145 L168* probably null Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Mak T C 13: 41,042,106 D377G possibly damaging Het
Matn2 T C 15: 34,388,768 C335R probably damaging Het
Mcoln2 C T 3: 146,180,222 S276F probably damaging Het
Morc3 C A 16: 93,866,503 N531K probably benign Het
Obp2a G A 2: 25,702,745 S175N probably benign Het
Olfr1437 A T 19: 12,321,984 V281E probably damaging Het
Olfr319 T C 11: 58,702,460 V253A probably benign Het
Olfr733 T G 14: 50,299,034 I92L possibly damaging Het
Osbpl3 C A 6: 50,323,093 K510N probably damaging Het
Papd4 G A 13: 93,175,565 A209V probably benign Het
Pcnx2 G A 8: 125,839,626 S1026F probably damaging Het
Pom121l2 A T 13: 21,983,344 D595V probably damaging Het
Poteg T A 8: 27,448,005 M1K probably null Het
Rbl1 G A 2: 157,175,659 L547F possibly damaging Het
Rpap3 T C 15: 97,701,121 T82A possibly damaging Het
Sema7a G A 9: 57,960,676 D512N probably benign Het
Sgpl1 C T 10: 61,105,451 V294M possibly damaging Het
Slc22a28 A G 19: 8,063,309 S526P probably damaging Het
Trim30b T G 7: 104,365,812 Q123P possibly damaging Het
Trpm5 A G 7: 143,085,209 L275P probably benign Het
Ttc33 A G 15: 5,189,794 E71G probably damaging Het
Unc13d T C 11: 116,073,655 T288A possibly damaging Het
Unc93a T A 17: 13,109,634 E444V probably benign Het
Usf3 T A 16: 44,218,172 M1005K probably benign Het
Vmn2r91 T C 17: 18,106,143 I230T probably benign Het
Wdr49 G A 3: 75,396,870 Q448* probably null Het
Zfp939 T A 7: 39,473,271 noncoding transcript Het
Other mutations in Dlgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Dlgap3 APN 4 127233897 missense probably benign 0.01
IGL03122:Dlgap3 APN 4 127195225 missense possibly damaging 0.86
IGL03259:Dlgap3 APN 4 127200284 missense probably benign 0.05
Compulsive UTSW 4 127195709 nonsense probably null
R0363:Dlgap3 UTSW 4 127235521 missense probably damaging 1.00
R1222:Dlgap3 UTSW 4 127194613 start codon destroyed probably null 0.01
R1386:Dlgap3 UTSW 4 127194926 missense possibly damaging 0.81
R2073:Dlgap3 UTSW 4 127195366 missense probably damaging 0.99
R2119:Dlgap3 UTSW 4 127236189 missense probably benign
R2696:Dlgap3 UTSW 4 127194623 missense probably damaging 1.00
R3076:Dlgap3 UTSW 4 127195706 missense probably damaging 1.00
R3738:Dlgap3 UTSW 4 127195606 missense probably damaging 0.99
R4344:Dlgap3 UTSW 4 127214348 missense possibly damaging 0.84
R4676:Dlgap3 UTSW 4 127233761 missense probably damaging 0.99
R4720:Dlgap3 UTSW 4 127195715 critical splice donor site probably null
R4893:Dlgap3 UTSW 4 127194983 missense probably damaging 1.00
R5384:Dlgap3 UTSW 4 127236330 missense probably damaging 1.00
R5841:Dlgap3 UTSW 4 127195400 missense probably damaging 1.00
R5870:Dlgap3 UTSW 4 127195709 nonsense probably null
R6379:Dlgap3 UTSW 4 127234974 missense probably damaging 1.00
R7028:Dlgap3 UTSW 4 127195517 missense possibly damaging 0.74
R7454:Dlgap3 UTSW 4 127235059 missense probably null 0.01
R7479:Dlgap3 UTSW 4 127194625 missense possibly damaging 0.72
R8104:Dlgap3 UTSW 4 127236154 missense probably damaging 0.99
X0024:Dlgap3 UTSW 4 127236172 missense probably damaging 1.00
Z1177:Dlgap3 UTSW 4 127194984 missense probably damaging 0.99
Z1177:Dlgap3 UTSW 4 127235498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAGTCCAACAAGATGGCTTC -3'
(R):5'- AGCCACTGTCACTGTCCAAATTGTC -3'

Sequencing Primer
(F):5'- CATACCAGCGAGGTCCAG -3'
(R):5'- CTGTCCAAATTGTCATCAGAGC -3'
Posted On2014-04-24