Incidental Mutation 'R1603:Atp8b3'
ID 176267
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene Name ATPase, class I, type 8B, member 3
Synonyms 1700042F02Rik, 1700056N23Rik, SAPLT
MMRRC Submission 039640-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R1603 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 80355418-80374958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 80361619 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 768 (A768S)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]
AlphaFold Q6UQ17
Predicted Effect probably benign
Transcript: ENSMUST00000020383
AA Change: A768S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: A768S

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220326
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,777,546 (GRCm39) S169N probably benign Het
Ace T A 11: 105,862,925 (GRCm39) S315R probably benign Het
Adamtsl1 A G 4: 86,333,767 (GRCm39) I1491V probably benign Het
Adrb2 A T 18: 62,312,579 (GRCm39) M82K probably damaging Het
Aebp2 A G 6: 140,587,979 (GRCm39) N350D probably damaging Het
Ankrd42 T C 7: 92,268,899 (GRCm39) probably benign Het
Asap1 A T 15: 64,001,106 (GRCm39) C492S probably damaging Het
Chga T A 12: 102,530,866 (GRCm39) probably null Het
Clca4b A G 3: 144,627,780 (GRCm39) V397A probably benign Het
Cntnap5a A C 1: 116,339,831 (GRCm39) T697P possibly damaging Het
Col12a1 T C 9: 79,520,244 (GRCm39) Q2810R probably damaging Het
Dchs1 G T 7: 105,411,977 (GRCm39) R1380S probably benign Het
Dgkg T A 16: 22,388,909 (GRCm39) probably benign Het
Dlgap3 G A 4: 127,089,021 (GRCm39) G206R probably damaging Het
Dnah5 A G 15: 28,295,131 (GRCm39) probably benign Het
Dnah5 A T 15: 28,449,326 (GRCm39) I4243L probably benign Het
Eif1ad16 C A 12: 87,985,134 (GRCm39) E136D probably benign Het
Fbxw22 G T 9: 109,207,915 (GRCm39) P452H probably benign Het
Fgl1 T A 8: 41,650,055 (GRCm39) D242V probably damaging Het
Gba2 C T 4: 43,567,823 (GRCm39) G794R probably damaging Het
Gimap7 A T 6: 48,700,864 (GRCm39) D150V probably damaging Het
Gm5334 T C 7: 68,268,620 (GRCm39) V13A probably benign Het
Grk5 T C 19: 61,057,800 (GRCm39) F167L probably benign Het
Ice1 A G 13: 70,751,472 (GRCm39) L1538P probably benign Het
Idh2 T G 7: 79,748,906 (GRCm39) E125A probably damaging Het
Kmt2a A T 9: 44,752,858 (GRCm39) probably null Het
Kras A T 6: 145,170,871 (GRCm39) L168* probably null Het
Lrrc66 G A 5: 73,764,769 (GRCm39) S758L possibly damaging Het
Mak T C 13: 41,195,582 (GRCm39) D377G possibly damaging Het
Matn2 T C 15: 34,388,914 (GRCm39) C335R probably damaging Het
Mcoln2 C T 3: 145,885,977 (GRCm39) S276F probably damaging Het
Morc3 C A 16: 93,663,391 (GRCm39) N531K probably benign Het
Obp2a G A 2: 25,592,757 (GRCm39) S175N probably benign Het
Or2ak6 T C 11: 58,593,286 (GRCm39) V253A probably benign Het
Or4n4b T G 14: 50,536,491 (GRCm39) I92L possibly damaging Het
Or5an1b A T 19: 12,299,348 (GRCm39) V281E probably damaging Het
Osbpl3 C A 6: 50,300,073 (GRCm39) K510N probably damaging Het
Pcnx2 G A 8: 126,566,365 (GRCm39) S1026F probably damaging Het
Pom121l2 A T 13: 22,167,514 (GRCm39) D595V probably damaging Het
Poteg T A 8: 27,938,033 (GRCm39) M1K probably null Het
Rbl1 G A 2: 157,017,579 (GRCm39) L547F possibly damaging Het
Rpap3 T C 15: 97,599,002 (GRCm39) T82A possibly damaging Het
Sema7a G A 9: 57,867,959 (GRCm39) D512N probably benign Het
Sgpl1 C T 10: 60,941,230 (GRCm39) V294M possibly damaging Het
Slc22a28 A G 19: 8,040,674 (GRCm39) S526P probably damaging Het
Spata31e2 T A 1: 26,724,650 (GRCm39) R177W probably damaging Het
Tent2 G A 13: 93,312,073 (GRCm39) A209V probably benign Het
Trim30b T G 7: 104,015,019 (GRCm39) Q123P possibly damaging Het
Trpm5 A G 7: 142,638,946 (GRCm39) L275P probably benign Het
Ttc33 A G 15: 5,219,275 (GRCm39) E71G probably damaging Het
Unc13d T C 11: 115,964,481 (GRCm39) T288A possibly damaging Het
Unc93a T A 17: 13,328,521 (GRCm39) E444V probably benign Het
Usf3 T A 16: 44,038,535 (GRCm39) M1005K probably benign Het
Vmn2r91 T C 17: 18,326,405 (GRCm39) I230T probably benign Het
Wdr49 G A 3: 75,304,177 (GRCm39) Q448* probably null Het
Zfp939 T A 7: 39,122,695 (GRCm39) noncoding transcript Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80,366,821 (GRCm39) missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80,361,998 (GRCm39) splice site probably benign
IGL00904:Atp8b3 APN 10 80,364,598 (GRCm39) missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80,360,210 (GRCm39) missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80,370,063 (GRCm39) splice site probably benign
IGL01448:Atp8b3 APN 10 80,356,256 (GRCm39) missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80,366,802 (GRCm39) nonsense probably null
IGL01754:Atp8b3 APN 10 80,366,795 (GRCm39) splice site probably null
IGL01809:Atp8b3 APN 10 80,355,845 (GRCm39) missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80,357,662 (GRCm39) missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80,363,067 (GRCm39) splice site probably benign
IGL02224:Atp8b3 APN 10 80,361,810 (GRCm39) splice site probably benign
IGL02377:Atp8b3 APN 10 80,356,128 (GRCm39) missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80,366,462 (GRCm39) missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80,366,438 (GRCm39) missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80,370,292 (GRCm39) missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80,366,420 (GRCm39) missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80,362,743 (GRCm39) missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80,355,918 (GRCm39) missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80,370,032 (GRCm39) missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80,366,852 (GRCm39) missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80,356,017 (GRCm39) missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80,368,376 (GRCm39) missense probably damaging 1.00
R1606:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80,357,635 (GRCm39) splice site probably null
R1717:Atp8b3 UTSW 10 80,364,631 (GRCm39) missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80,365,912 (GRCm39) missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80,361,220 (GRCm39) nonsense probably null
R2138:Atp8b3 UTSW 10 80,362,939 (GRCm39) missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80,366,822 (GRCm39) missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80,362,728 (GRCm39) missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80,370,017 (GRCm39) missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80,355,746 (GRCm39) missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80,362,014 (GRCm39) missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80,365,540 (GRCm39) missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4518:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4519:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4619:Atp8b3 UTSW 10 80,361,858 (GRCm39) missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80,361,457 (GRCm39) missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80,372,604 (GRCm39) splice site probably null
R4774:Atp8b3 UTSW 10 80,372,156 (GRCm39) missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80,360,188 (GRCm39) missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80,357,676 (GRCm39) missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80,365,533 (GRCm39) missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80,356,007 (GRCm39) missense probably benign
R5990:Atp8b3 UTSW 10 80,361,531 (GRCm39) missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80,365,515 (GRCm39) missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80,356,157 (GRCm39) splice site probably null
R6748:Atp8b3 UTSW 10 80,361,058 (GRCm39) missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80,361,895 (GRCm39) missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80,365,552 (GRCm39) missense probably damaging 0.99
R7051:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7052:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80,365,926 (GRCm39) missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80,365,463 (GRCm39) critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80,360,240 (GRCm39) missense probably damaging 0.99
R7921:Atp8b3 UTSW 10 80,366,437 (GRCm39) missense probably damaging 1.00
R8077:Atp8b3 UTSW 10 80,366,858 (GRCm39) missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80,365,650 (GRCm39) missense probably damaging 0.96
R8354:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8454:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8501:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign
R8712:Atp8b3 UTSW 10 80,365,923 (GRCm39) missense possibly damaging 0.52
R8962:Atp8b3 UTSW 10 80,355,896 (GRCm39) missense probably benign 0.13
R9129:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R9333:Atp8b3 UTSW 10 80,360,180 (GRCm39) missense probably benign 0.01
R9438:Atp8b3 UTSW 10 80,361,409 (GRCm39) missense probably damaging 1.00
R9486:Atp8b3 UTSW 10 80,366,821 (GRCm39) missense probably damaging 1.00
R9554:Atp8b3 UTSW 10 80,360,197 (GRCm39) missense probably damaging 1.00
R9570:Atp8b3 UTSW 10 80,361,822 (GRCm39) missense probably benign 0.05
R9682:Atp8b3 UTSW 10 80,371,230 (GRCm39) missense probably damaging 1.00
R9748:Atp8b3 UTSW 10 80,364,407 (GRCm39) missense probably damaging 0.96
RF006:Atp8b3 UTSW 10 80,362,070 (GRCm39) missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80,366,911 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCATTTGGAGGCCAGGTCTACAAAG -3'
(R):5'- GAAGGCGTTCAAAATGATGACCCAC -3'

Sequencing Primer
(F):5'- GGTCTACAAAGGCCCTCTC -3'
(R):5'- CAACATGGCCTTGGTTATCAATGG -3'
Posted On 2014-04-24