Mutagenetix > Incidental Mutation

Incidental Mutation 'R1603:Atp8b3'

176267

Institutional Source

Beutler Lab

Gene Symbol

Atp8b3

Ensembl Gene

ENSMUSG00000003341

Gene Name

ATPase, class I, type 8B, member 3

Synonyms

1700042F02Rik, SAPLT, 1700056N23Rik

MMRRC Submission

039640-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R1603 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80519584-80539124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 80525785 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 768 (A768S)

Ref Sequence

ENSEMBL: ENSMUSP00000020383 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]

AlphaFold

Q6UQ17

Predicted Effect

probably benign
Transcript: ENSMUST00000020383
AA Change: A768S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: A768S

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	20	97	9.3e-29	PFAM
Pfam:E1-E2_ATPase	121	367	2.2e-10	PFAM
Pfam:HAD	404	866	3.7e-17	PFAM
Pfam:Cation_ATPase	481	580	8.3e-12	PFAM
Pfam:PhoLip_ATPase_C	883	1135	4.2e-61	PFAM
low complexity region	1140	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220326

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.3%

Validation Efficiency

96% (65/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032F04Rik	G	A	3: 68,870,213	S169N	probably benign	Het
4931408C20Rik	T	A	1: 26,685,569	R177W	probably damaging	Het
Ace	T	A	11: 105,972,099	S315R	probably benign	Het
Adamtsl1	A	G	4: 86,415,530	I1491V	probably benign	Het
Adrb2	A	T	18: 62,179,508	M82K	probably damaging	Het
Aebp2	A	G	6: 140,642,253	N350D	probably damaging	Het
Ankrd42	T	C	7: 92,619,691		probably benign	Het
Asap1	A	T	15: 64,129,257	C492S	probably damaging	Het
Chga	T	A	12: 102,564,607		probably null	Het
Clca4b	A	G	3: 144,922,019	V397A	probably benign	Het
Cntnap5a	A	C	1: 116,412,101	T697P	possibly damaging	Het
Col12a1	T	C	9: 79,612,962	Q2810R	probably damaging	Het
Dchs1	G	T	7: 105,762,770	R1380S	probably benign	Het
Dgkg	T	A	16: 22,570,159		probably benign	Het
Dlgap3	G	A	4: 127,195,228	G206R	probably damaging	Het
Dnah5	A	G	15: 28,294,985		probably benign	Het
Dnah5	A	T	15: 28,449,180	I4243L	probably benign	Het
Fbxw22	G	T	9: 109,378,847	P452H	probably benign	Het
Fgl1	T	A	8: 41,197,018	D242V	probably damaging	Het
Gba2	C	T	4: 43,567,823	G794R	probably damaging	Het
Gimap7	A	T	6: 48,723,930	D150V	probably damaging	Het
Gm5334	T	C	7: 68,618,872	V13A	probably benign	Het
Gm6803	C	A	12: 88,018,364	E136D	probably benign	Het
Grk5	T	C	19: 61,069,362	F167L	probably benign	Het
Ice1	A	G	13: 70,603,353	L1538P	probably benign	Het
Idh2	T	G	7: 80,099,158	E125A	probably damaging	Het
Kmt2a	A	T	9: 44,841,561		probably null	Het
Kras	A	T	6: 145,225,145	L168*	probably null	Het
Lrrc66	G	A	5: 73,607,426	S758L	possibly damaging	Het
Mak	T	C	13: 41,042,106	D377G	possibly damaging	Het
Matn2	T	C	15: 34,388,768	C335R	probably damaging	Het
Mcoln2	C	T	3: 146,180,222	S276F	probably damaging	Het
Morc3	C	A	16: 93,866,503	N531K	probably benign	Het
Obp2a	G	A	2: 25,702,745	S175N	probably benign	Het
Olfr1437	A	T	19: 12,321,984	V281E	probably damaging	Het
Olfr319	T	C	11: 58,702,460	V253A	probably benign	Het
Olfr733	T	G	14: 50,299,034	I92L	possibly damaging	Het
Osbpl3	C	A	6: 50,323,093	K510N	probably damaging	Het
Papd4	G	A	13: 93,175,565	A209V	probably benign	Het
Pcnx2	G	A	8: 125,839,626	S1026F	probably damaging	Het
Pom121l2	A	T	13: 21,983,344	D595V	probably damaging	Het
Poteg	T	A	8: 27,448,005	M1K	probably null	Het
Rbl1	G	A	2: 157,175,659	L547F	possibly damaging	Het
Rpap3	T	C	15: 97,701,121	T82A	possibly damaging	Het
Sema7a	G	A	9: 57,960,676	D512N	probably benign	Het
Sgpl1	C	T	10: 61,105,451	V294M	possibly damaging	Het
Slc22a28	A	G	19: 8,063,309	S526P	probably damaging	Het
Trim30b	T	G	7: 104,365,812	Q123P	possibly damaging	Het
Trpm5	A	G	7: 143,085,209	L275P	probably benign	Het
Ttc33	A	G	15: 5,189,794	E71G	probably damaging	Het
Unc13d	T	C	11: 116,073,655	T288A	possibly damaging	Het
Unc93a	T	A	17: 13,109,634	E444V	probably benign	Het
Usf3	T	A	16: 44,218,172	M1005K	probably benign	Het
Vmn2r91	T	C	17: 18,106,143	I230T	probably benign	Het
Wdr49	G	A	3: 75,396,870	Q448*	probably null	Het
Zfp939	T	A	7: 39,473,271		noncoding transcript	Het

Other mutations in Atp8b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Atp8b3	APN	10	80530987	missense	probably damaging	1.00
IGL00484:Atp8b3	APN	10	80526164	splice site	probably benign
IGL00904:Atp8b3	APN	10	80528764	missense	probably damaging	1.00
IGL01326:Atp8b3	APN	10	80524376	missense	probably damaging	0.98
IGL01368:Atp8b3	APN	10	80534229	splice site	probably benign
IGL01448:Atp8b3	APN	10	80520422	missense	probably benign	0.02
IGL01556:Atp8b3	APN	10	80530968	nonsense	probably null
IGL01754:Atp8b3	APN	10	80530961	splice site	probably null
IGL01809:Atp8b3	APN	10	80520011	missense	probably benign	0.02
IGL01895:Atp8b3	APN	10	80521828	missense	possibly damaging	0.80
IGL02184:Atp8b3	APN	10	80527233	splice site	probably benign
IGL02224:Atp8b3	APN	10	80525976	splice site	probably benign
IGL02377:Atp8b3	APN	10	80520294	missense	probably benign	0.06
IGL02405:Atp8b3	APN	10	80530628	missense	probably damaging	1.00
IGL03090:Atp8b3	APN	10	80530604	missense	probably damaging	1.00
IGL03244:Atp8b3	APN	10	80534458	missense	probably damaging	1.00
PIT4544001:Atp8b3	UTSW	10	80530586	missense	probably benign	0.14
R0277:Atp8b3	UTSW	10	80526909	missense	probably benign	0.21
R0908:Atp8b3	UTSW	10	80520084	missense	probably benign	0.03
R0973:Atp8b3	UTSW	10	80534198	missense	probably damaging	1.00
R1069:Atp8b3	UTSW	10	80531018	missense	probably damaging	1.00
R1087:Atp8b3	UTSW	10	80520183	missense	probably benign	0.00
R1553:Atp8b3	UTSW	10	80532542	missense	probably damaging	1.00
R1606:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R1707:Atp8b3	UTSW	10	80521801	splice site	probably null
R1717:Atp8b3	UTSW	10	80528797	missense	probably damaging	1.00
R1876:Atp8b3	UTSW	10	80530078	missense	possibly damaging	0.70
R1939:Atp8b3	UTSW	10	80525386	nonsense	probably null
R2138:Atp8b3	UTSW	10	80527105	missense	possibly damaging	0.79
R2239:Atp8b3	UTSW	10	80530988	missense	probably damaging	1.00
R2429:Atp8b3	UTSW	10	80526894	missense	probably benign	0.02
R2696:Atp8b3	UTSW	10	80534183	missense	possibly damaging	0.94
R2910:Atp8b3	UTSW	10	80519912	missense	possibly damaging	0.90
R3424:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3425:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3432:Atp8b3	UTSW	10	80526180	missense	probably benign	0.10
R3841:Atp8b3	UTSW	10	80529706	missense	possibly damaging	0.95
R4515:Atp8b3	UTSW	10	80523847	missense	probably benign
R4518:Atp8b3	UTSW	10	80523847	missense	probably benign
R4519:Atp8b3	UTSW	10	80523847	missense	probably benign
R4619:Atp8b3	UTSW	10	80526024	missense	possibly damaging	0.67
R4648:Atp8b3	UTSW	10	80525623	missense	possibly damaging	0.94
R4709:Atp8b3	UTSW	10	80536770	splice site	probably null
R4774:Atp8b3	UTSW	10	80536322	missense	probably damaging	1.00
R4796:Atp8b3	UTSW	10	80524354	missense	probably damaging	1.00
R5000:Atp8b3	UTSW	10	80521842	missense	possibly damaging	0.82
R5398:Atp8b3	UTSW	10	80529699	missense	probably damaging	1.00
R5778:Atp8b3	UTSW	10	80520173	missense	probably benign
R5990:Atp8b3	UTSW	10	80525697	missense	possibly damaging	0.65
R6124:Atp8b3	UTSW	10	80529681	missense	probably damaging	1.00
R6427:Atp8b3	UTSW	10	80520323	splice site	probably null
R6748:Atp8b3	UTSW	10	80525224	missense	possibly damaging	0.56
R6756:Atp8b3	UTSW	10	80526061	missense	possibly damaging	0.76
R7051:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7051:Atp8b3	UTSW	10	80529718	missense	probably damaging	0.99
R7052:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7418:Atp8b3	UTSW	10	80530092	missense	probably damaging	0.99
R7426:Atp8b3	UTSW	10	80529629	critical splice donor site	probably null
R7625:Atp8b3	UTSW	10	80520146	missense	probably benign	0.00
R7673:Atp8b3	UTSW	10	80524406	missense	probably damaging	0.99
R7921:Atp8b3	UTSW	10	80530603	missense	probably damaging	1.00
R8077:Atp8b3	UTSW	10	80531024	missense	possibly damaging	0.95
R8235:Atp8b3	UTSW	10	80529816	missense	probably damaging	0.96
R8354:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8454:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8501:Atp8b3	UTSW	10	80520146	missense	probably benign
R8712:Atp8b3	UTSW	10	80530089	missense	possibly damaging	0.52
R8962:Atp8b3	UTSW	10	80520062	missense	probably benign	0.13
R9129:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R9333:Atp8b3	UTSW	10	80524346	missense	probably benign	0.01
R9438:Atp8b3	UTSW	10	80525575	missense	probably damaging	1.00
R9486:Atp8b3	UTSW	10	80530987	missense	probably damaging	1.00
R9554:Atp8b3	UTSW	10	80524363	missense	probably damaging	1.00
R9570:Atp8b3	UTSW	10	80525988	missense	probably benign	0.05
R9682:Atp8b3	UTSW	10	80535396	missense	probably damaging	1.00
R9748:Atp8b3	UTSW	10	80528573	missense	probably damaging	0.96
RF006:Atp8b3	UTSW	10	80526236	missense	probably benign	0.15
Z1177:Atp8b3	UTSW	10	80531077	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GCATTTGGAGGCCAGGTCTACAAAG -3'
(R):5'- GAAGGCGTTCAAAATGATGACCCAC -3'

Sequencing Primer
(F):5'- GGTCTACAAAGGCCCTCTC -3'
(R):5'- CAACATGGCCTTGGTTATCAATGG -3'

Posted On

2014-04-24