Incidental Mutation 'R1603:Atp8b3'
ID176267
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene NameATPase, class I, type 8B, member 3
Synonyms1700042F02Rik, SAPLT, 1700056N23Rik
MMRRC Submission 039640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R1603 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80519584-80539124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80525785 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 768 (A768S)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]
Predicted Effect probably benign
Transcript: ENSMUST00000020383
AA Change: A768S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: A768S

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220326
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4931408C20Rik T A 1: 26,685,569 R177W probably damaging Het
Ace T A 11: 105,972,099 S315R probably benign Het
Adamtsl1 A G 4: 86,415,530 I1491V probably benign Het
Adrb2 A T 18: 62,179,508 M82K probably damaging Het
Aebp2 A G 6: 140,642,253 N350D probably damaging Het
Ankrd42 T C 7: 92,619,691 probably benign Het
Asap1 A T 15: 64,129,257 C492S probably damaging Het
Chga T A 12: 102,564,607 probably null Het
Clca4b A G 3: 144,922,019 V397A probably benign Het
Cntnap5a A C 1: 116,412,101 T697P possibly damaging Het
Col12a1 T C 9: 79,612,962 Q2810R probably damaging Het
Dchs1 G T 7: 105,762,770 R1380S probably benign Het
Dgkg T A 16: 22,570,159 probably benign Het
Dlgap3 G A 4: 127,195,228 G206R probably damaging Het
Dnah5 A G 15: 28,294,985 probably benign Het
Dnah5 A T 15: 28,449,180 I4243L probably benign Het
Fbxw22 G T 9: 109,378,847 P452H probably benign Het
Fgl1 T A 8: 41,197,018 D242V probably damaging Het
Gba2 C T 4: 43,567,823 G794R probably damaging Het
Gimap7 A T 6: 48,723,930 D150V probably damaging Het
Gm5334 T C 7: 68,618,872 V13A probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Grk5 T C 19: 61,069,362 F167L probably benign Het
Ice1 A G 13: 70,603,353 L1538P probably benign Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Kmt2a A T 9: 44,841,561 probably null Het
Kras A T 6: 145,225,145 L168* probably null Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Mak T C 13: 41,042,106 D377G possibly damaging Het
Matn2 T C 15: 34,388,768 C335R probably damaging Het
Mcoln2 C T 3: 146,180,222 S276F probably damaging Het
Morc3 C A 16: 93,866,503 N531K probably benign Het
Obp2a G A 2: 25,702,745 S175N probably benign Het
Olfr1437 A T 19: 12,321,984 V281E probably damaging Het
Olfr319 T C 11: 58,702,460 V253A probably benign Het
Olfr733 T G 14: 50,299,034 I92L possibly damaging Het
Osbpl3 C A 6: 50,323,093 K510N probably damaging Het
Papd4 G A 13: 93,175,565 A209V probably benign Het
Pcnx2 G A 8: 125,839,626 S1026F probably damaging Het
Pom121l2 A T 13: 21,983,344 D595V probably damaging Het
Poteg T A 8: 27,448,005 M1K probably null Het
Rbl1 G A 2: 157,175,659 L547F possibly damaging Het
Rpap3 T C 15: 97,701,121 T82A possibly damaging Het
Sema7a G A 9: 57,960,676 D512N probably benign Het
Sgpl1 C T 10: 61,105,451 V294M possibly damaging Het
Slc22a28 A G 19: 8,063,309 S526P probably damaging Het
Trim30b T G 7: 104,365,812 Q123P possibly damaging Het
Trpm5 A G 7: 143,085,209 L275P probably benign Het
Ttc33 A G 15: 5,189,794 E71G probably damaging Het
Unc13d T C 11: 116,073,655 T288A possibly damaging Het
Unc93a T A 17: 13,109,634 E444V probably benign Het
Usf3 T A 16: 44,218,172 M1005K probably benign Het
Vmn2r91 T C 17: 18,106,143 I230T probably benign Het
Wdr49 G A 3: 75,396,870 Q448* probably null Het
Zfp939 T A 7: 39,473,271 noncoding transcript Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80530987 missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80526164 splice site probably benign
IGL00904:Atp8b3 APN 10 80528764 missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80524376 missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80534229 splice site probably benign
IGL01448:Atp8b3 APN 10 80520422 missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80530968 nonsense probably null
IGL01754:Atp8b3 APN 10 80530961 splice site probably null
IGL01809:Atp8b3 APN 10 80520011 missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80521828 missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80527233 splice site probably benign
IGL02224:Atp8b3 APN 10 80525976 splice site probably benign
IGL02377:Atp8b3 APN 10 80520294 missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80530628 missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80530604 missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80534458 missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80530586 missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80526909 missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80520084 missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80534198 missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80531018 missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80520183 missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80532542 missense probably damaging 1.00
R1606:Atp8b3 UTSW 10 80532578 missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80521801 unclassified probably null
R1717:Atp8b3 UTSW 10 80528797 missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80530078 missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80525386 nonsense probably null
R2138:Atp8b3 UTSW 10 80527105 missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80530988 missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80526894 missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80534183 missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80519912 missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80526180 missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80529706 missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80523847 missense probably benign
R4518:Atp8b3 UTSW 10 80523847 missense probably benign
R4519:Atp8b3 UTSW 10 80523847 missense probably benign
R4619:Atp8b3 UTSW 10 80526024 missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80525623 missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80536770 unclassified probably null
R4774:Atp8b3 UTSW 10 80536322 missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80524354 missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80521842 missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80529699 missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80520173 missense probably benign
R5990:Atp8b3 UTSW 10 80525697 missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80529681 missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80520323 unclassified probably null
R6748:Atp8b3 UTSW 10 80525224 missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80526061 missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80520024 missense probably benign 0.02
R7051:Atp8b3 UTSW 10 80529718 missense probably damaging 0.99
R7052:Atp8b3 UTSW 10 80520024 missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80530092 missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80529629 critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80520146 missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80524406 missense probably damaging 0.99
R8077:Atp8b3 UTSW 10 80531024 missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80529816 missense probably damaging 0.96
RF006:Atp8b3 UTSW 10 80526236 missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80531077 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCATTTGGAGGCCAGGTCTACAAAG -3'
(R):5'- GAAGGCGTTCAAAATGATGACCCAC -3'

Sequencing Primer
(F):5'- GGTCTACAAAGGCCCTCTC -3'
(R):5'- CAACATGGCCTTGGTTATCAATGG -3'
Posted On2014-04-24