Mutagenetix > Incidental Mutations

Incidental Mutation 'R1603:Ice1'

176276

Institutional Source

Beutler Lab

Gene Symbol

Ice1

Ensembl Gene

ENSMUSG00000034525

Gene Name

interactor of little elongation complex ELL subunit 1

Synonyms

BC018507

MMRRC Submission

039640-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.918) question?

Stock #

R1603 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70551707-70637634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70603353 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1538 (L1538P)

Ref Sequence

ENSEMBL: ENSMUSP00000036482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]

Predicted Effect

probably benign
Transcript: ENSMUST00000043493
AA Change: L1538P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: L1538P

Domain	Start	End	E-Value	Type
coiled coil region	22	185	N/A	INTRINSIC
low complexity region	276	292	N/A	INTRINSIC
low complexity region	338	351	N/A	INTRINSIC
low complexity region	372	378	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	606	619	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
low complexity region	946	958	N/A	INTRINSIC
low complexity region	1061	1073	N/A	INTRINSIC
low complexity region	1329	1352	N/A	INTRINSIC
low complexity region	1595	1604	N/A	INTRINSIC
low complexity region	1656	1671	N/A	INTRINSIC
SCOP:d1gw5a_	2026	2223	5e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220637

Predicted Effect

probably benign
Transcript: ENSMUST00000222568

Predicted Effect

probably benign
Transcript: ENSMUST00000222627

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.3%

Validation Efficiency

96% (65/68)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032F04Rik	G	A	3: 68,870,213	S169N	probably benign	Het
4931408C20Rik	T	A	1: 26,685,569	R177W	probably damaging	Het
Ace	T	A	11: 105,972,099	S315R	probably benign	Het
Adamtsl1	A	G	4: 86,415,530	I1491V	probably benign	Het
Adrb2	A	T	18: 62,179,508	M82K	probably damaging	Het
Aebp2	A	G	6: 140,642,253	N350D	probably damaging	Het
Ankrd42	T	C	7: 92,619,691		probably benign	Het
Asap1	A	T	15: 64,129,257	C492S	probably damaging	Het
Atp8b3	C	A	10: 80,525,785	A768S	probably benign	Het
Chga	T	A	12: 102,564,607		probably null	Het
Clca4b	A	G	3: 144,922,019	V397A	probably benign	Het
Cntnap5a	A	C	1: 116,412,101	T697P	possibly damaging	Het
Col12a1	T	C	9: 79,612,962	Q2810R	probably damaging	Het
Dchs1	G	T	7: 105,762,770	R1380S	probably benign	Het
Dgkg	T	A	16: 22,570,159		probably benign	Het
Dlgap3	G	A	4: 127,195,228	G206R	probably damaging	Het
Dnah5	A	T	15: 28,449,180	I4243L	probably benign	Het
Dnah5	A	G	15: 28,294,985		probably benign	Het
Fbxw22	G	T	9: 109,378,847	P452H	probably benign	Het
Fgl1	T	A	8: 41,197,018	D242V	probably damaging	Het
Gba2	C	T	4: 43,567,823	G794R	probably damaging	Het
Gimap7	A	T	6: 48,723,930	D150V	probably damaging	Het
Gm5334	T	C	7: 68,618,872	V13A	probably benign	Het
Gm6803	C	A	12: 88,018,364	E136D	probably benign	Het
Grk5	T	C	19: 61,069,362	F167L	probably benign	Het
Idh2	T	G	7: 80,099,158	E125A	probably damaging	Het
Kmt2a	A	T	9: 44,841,561		probably null	Het
Kras	A	T	6: 145,225,145	L168*	probably null	Het
Lrrc66	G	A	5: 73,607,426	S758L	possibly damaging	Het
Mak	T	C	13: 41,042,106	D377G	possibly damaging	Het
Matn2	T	C	15: 34,388,768	C335R	probably damaging	Het
Mcoln2	C	T	3: 146,180,222	S276F	probably damaging	Het
Morc3	C	A	16: 93,866,503	N531K	probably benign	Het
Obp2a	G	A	2: 25,702,745	S175N	probably benign	Het
Olfr1437	A	T	19: 12,321,984	V281E	probably damaging	Het
Olfr319	T	C	11: 58,702,460	V253A	probably benign	Het
Olfr733	T	G	14: 50,299,034	I92L	possibly damaging	Het
Osbpl3	C	A	6: 50,323,093	K510N	probably damaging	Het
Papd4	G	A	13: 93,175,565	A209V	probably benign	Het
Pcnx2	G	A	8: 125,839,626	S1026F	probably damaging	Het
Pom121l2	A	T	13: 21,983,344	D595V	probably damaging	Het
Poteg	T	A	8: 27,448,005	M1K	probably null	Het
Rbl1	G	A	2: 157,175,659	L547F	possibly damaging	Het
Rpap3	T	C	15: 97,701,121	T82A	possibly damaging	Het
Sema7a	G	A	9: 57,960,676	D512N	probably benign	Het
Sgpl1	C	T	10: 61,105,451	V294M	possibly damaging	Het
Slc22a28	A	G	19: 8,063,309	S526P	probably damaging	Het
Trim30b	T	G	7: 104,365,812	Q123P	possibly damaging	Het
Trpm5	A	G	7: 143,085,209	L275P	probably benign	Het
Ttc33	A	G	15: 5,189,794	E71G	probably damaging	Het
Unc13d	T	C	11: 116,073,655	T288A	possibly damaging	Het
Unc93a	T	A	17: 13,109,634	E444V	probably benign	Het
Usf3	T	A	16: 44,218,172	M1005K	probably benign	Het
Vmn2r91	T	C	17: 18,106,143	I230T	probably benign	Het
Wdr49	G	A	3: 75,396,870	Q448*	probably null	Het
Zfp939	T	A	7: 39,473,271		noncoding transcript	Het

Other mutations in Ice1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Ice1	APN	13	70602289	missense	probably damaging	1.00
IGL01155:Ice1	APN	13	70604082	missense	possibly damaging	0.93
IGL01298:Ice1	APN	13	70604904	missense	possibly damaging	0.93
IGL01797:Ice1	APN	13	70623946	missense	probably damaging	1.00
IGL02423:Ice1	APN	13	70592599	missense	probably damaging	1.00
IGL02583:Ice1	APN	13	70605735	missense	possibly damaging	0.80
IGL02794:Ice1	APN	13	70609159	missense	possibly damaging	0.95
IGL02882:Ice1	APN	13	70624474	splice site	probably benign
IGL02929:Ice1	APN	13	70596203	missense	probably damaging	1.00
IGL03343:Ice1	APN	13	70602929	missense	probably damaging	1.00
IGL03384:Ice1	APN	13	70603249	missense	probably benign	0.00
PIT4651001:Ice1	UTSW	13	70623921	critical splice donor site	probably null
R0078:Ice1	UTSW	13	70603348	missense	probably damaging	0.98
R0081:Ice1	UTSW	13	70619044	nonsense	probably null
R0281:Ice1	UTSW	13	70604047	missense	possibly damaging	0.64
R0557:Ice1	UTSW	13	70601191	missense	probably benign	0.08
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0974:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R1033:Ice1	UTSW	13	70606594	missense	probably damaging	0.96
R1371:Ice1	UTSW	13	70596221	missense	probably damaging	1.00
R1525:Ice1	UTSW	13	70605410	missense	probably benign	0.01
R1539:Ice1	UTSW	13	70605904	missense	probably damaging	1.00
R1596:Ice1	UTSW	13	70604895	missense	possibly damaging	0.94
R1680:Ice1	UTSW	13	70605448	missense	probably benign	0.00
R1737:Ice1	UTSW	13	70606325	missense	probably damaging	0.99
R1766:Ice1	UTSW	13	70604442	missense	possibly damaging	0.78
R1774:Ice1	UTSW	13	70604553	missense	probably damaging	1.00
R1834:Ice1	UTSW	13	70615338	missense	probably damaging	0.99
R1840:Ice1	UTSW	13	70606218	missense	probably benign	0.00
R1898:Ice1	UTSW	13	70602307	missense	possibly damaging	0.83
R1930:Ice1	UTSW	13	70605083	missense	probably benign	0.18
R2000:Ice1	UTSW	13	70602427	missense	possibly damaging	0.58
R2106:Ice1	UTSW	13	70605622	missense	probably benign	0.00
R2293:Ice1	UTSW	13	70614957	missense	probably damaging	1.00
R2377:Ice1	UTSW	13	70602780	missense	probably damaging	1.00
R2909:Ice1	UTSW	13	70596173	missense	probably damaging	1.00
R2965:Ice1	UTSW	13	70602578	missense	probably benign	0.31
R3730:Ice1	UTSW	13	70603240	missense	probably damaging	1.00
R3886:Ice1	UTSW	13	70605370	missense	probably benign	0.00
R3914:Ice1	UTSW	13	70606084	missense	probably benign	0.30
R4051:Ice1	UTSW	13	70603527	missense	probably damaging	1.00
R4321:Ice1	UTSW	13	70603110	missense	possibly damaging	0.83
R4499:Ice1	UTSW	13	70609027	missense	possibly damaging	0.87
R4729:Ice1	UTSW	13	70606384	missense	probably damaging	1.00
R5078:Ice1	UTSW	13	70604850	missense	probably benign
R5431:Ice1	UTSW	13	70592650	missense	probably damaging	1.00
R5722:Ice1	UTSW	13	70615100	missense	possibly damaging	0.95
R5881:Ice1	UTSW	13	70606501	missense	probably benign	0.04
R5914:Ice1	UTSW	13	70606377	missense	possibly damaging	0.93
R6171:Ice1	UTSW	13	70606731	missense	probably benign
R6253:Ice1	UTSW	13	70603164	missense	probably damaging	1.00
R6274:Ice1	UTSW	13	70594839	missense	probably damaging	0.97
R6518:Ice1	UTSW	13	70606309	missense	possibly damaging	0.89
R6665:Ice1	UTSW	13	70603473	missense	possibly damaging	0.85
R6714:Ice1	UTSW	13	70615263	splice site	probably null
R6853:Ice1	UTSW	13	70603302	missense	possibly damaging	0.92
R6917:Ice1	UTSW	13	70594894	missense	probably damaging	1.00
R7032:Ice1	UTSW	13	70596164	missense	probably damaging	0.99
R7176:Ice1	UTSW	13	70624406	critical splice donor site	probably null
R7352:Ice1	UTSW	13	70606102	nonsense	probably null
R7445:Ice1	UTSW	13	70596167	missense
R7646:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7647:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7648:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70605483	missense	probably damaging	1.00
R7812:Ice1	UTSW	13	70603005	missense	possibly damaging	0.63
R8061:Ice1	UTSW	13	70603732	missense	probably damaging	1.00
R8129:Ice1	UTSW	13	70606201	missense	probably benign	0.02
R8283:Ice1	UTSW	13	70604430	missense	probably damaging	0.97
R8303:Ice1	UTSW	13	70606407	missense	probably benign	0.04
R8444:Ice1	UTSW	13	70604376	missense	probably damaging	1.00
R8474:Ice1	UTSW	13	70604447	missense	probably benign	0.42
X0026:Ice1	UTSW	13	70592602	missense	probably damaging	1.00
Z1176:Ice1	UTSW	13	70605201	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGCTCAGAGTGTCAGGAGAACAG -3'
(R):5'- TGGTGCCCAGGAGGATATTTCCAG -3'

Sequencing Primer
(F):5'- TGTCAGGAGAACAGTTGGTGG -3'
(R):5'- GTGCCAACTTTGATAAGAGTCGTC -3'

Posted On

2014-04-24