Incidental Mutation 'R1604:Gad2'
ID176301
Institutional Source Beutler Lab
Gene Symbol Gad2
Ensembl Gene ENSMUSG00000026787
Gene Nameglutamic acid decarboxylase 2
SynonymsGad-2, 6330404F12Rik, GAD(65), GAD65
MMRRC Submission 039641-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1604 (G1)
Quality Score127
Status Not validated
Chromosome2
Chromosomal Location22622205-22693874 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 22623840 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028123]
Predicted Effect probably null
Transcript: ENSMUST00000028123
SMART Domains Protein: ENSMUSP00000028123
Gene: ENSMUSG00000026787

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 138 509 7.8e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156728
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit spontaneous (frequently fatal) seizures, increased anxiety-like behavior, and reduced intermale aggression. Heterozygotes show reduced aggressiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T C 15: 84,406,471 M212V probably benign Het
Aldoart2 A G 12: 55,565,620 D110G probably damaging Het
Angptl2 T C 2: 33,243,773 M369T possibly damaging Het
Anks3 C T 16: 4,948,253 V151M probably damaging Het
Arl6ip6 T C 2: 53,192,496 L125P probably damaging Het
Bmp1 T C 14: 70,508,004 Q247R possibly damaging Het
Ccdc30 A G 4: 119,331,596 I491T probably damaging Het
Cdhr1 T A 14: 37,095,093 I104F probably benign Het
Cdk17 G T 10: 93,232,498 M372I probably damaging Het
Cyp2c54 A G 19: 40,070,343 V215A probably benign Het
D430041D05Rik T A 2: 104,205,142 I1614F probably damaging Het
Ddx55 A G 5: 124,559,306 N244D probably damaging Het
Dopey2 G T 16: 93,762,570 V617F probably benign Het
Erbb4 G T 1: 68,346,569 A287E possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gm17421 G A 12: 113,369,535 noncoding transcript Het
Gm9894 T A 13: 67,764,889 noncoding transcript Het
Gnpat T C 8: 124,876,961 S193P probably damaging Het
Gpr20 C T 15: 73,696,004 V179M probably damaging Het
Hdgf T A 3: 87,914,040 probably null Het
Itgb8 A T 12: 119,202,530 L89M probably damaging Het
Lnx2 T C 5: 147,029,325 D328G probably benign Het
Lrguk A G 6: 34,072,370 T341A possibly damaging Het
Map1b A G 13: 99,429,572 S2214P unknown Het
Mms22l T C 4: 24,502,804 F131L probably damaging Het
Msmo1 A G 8: 64,727,655 I75T probably damaging Het
Olfr444 G A 6: 42,955,716 A73T possibly damaging Het
Olfr639 G T 7: 104,011,955 A249E probably damaging Het
Olfr891 A G 9: 38,180,349 V158A probably benign Het
Olfr924 T G 9: 38,848,704 F197V probably benign Het
Olfr934 A T 9: 38,982,618 M142K probably benign Het
Pkhd1l1 C T 15: 44,467,367 R113* probably null Het
Polr2m T C 9: 71,483,677 D81G probably damaging Het
Ppp1r15b T A 1: 133,132,549 M268K probably benign Het
Ptprcap T A 19: 4,156,074 L52* probably null Het
Rasgrp2 C T 19: 6,407,057 T277I possibly damaging Het
Rrbp1 T C 2: 143,989,390 N286D probably damaging Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Scrib A C 15: 76,048,240 S1557A probably damaging Het
Sergef C A 7: 46,443,359 V409L probably benign Het
Slc6a13 A G 6: 121,332,369 M280V probably benign Het
Slc9a8 C T 2: 167,471,432 P409S probably benign Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Spc25 T C 2: 69,205,154 D4G probably damaging Het
Specc1 C T 11: 62,043,057 R88C probably damaging Het
Srsf11 C T 3: 158,019,311 probably null Het
Stt3b T C 9: 115,250,927 E639G probably damaging Het
Sult3a1 A C 10: 33,866,620 E81A probably damaging Het
Taf1b G A 12: 24,556,624 G481D probably benign Het
Tgm4 T C 9: 123,045,064 V123A probably benign Het
Tie1 G T 4: 118,474,407 H973N probably damaging Het
Tmem117 C T 15: 95,094,544 R362W probably damaging Het
Txnip A T 3: 96,558,961 Q107L probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Vcan A G 13: 89,689,661 V1628A probably benign Het
Vmn2r115 T A 17: 23,345,271 M139K probably benign Het
Wwp1 A G 4: 19,659,709 V193A probably benign Het
Zcchc8 C T 5: 123,700,658 A606T probably benign Het
Zfp131 G A 13: 119,768,780 L371F probably damaging Het
Zfp518b T C 5: 38,673,606 D352G probably damaging Het
Zfp784 A G 7: 5,036,454 probably benign Het
Zfp940 A T 7: 29,846,075 F136I probably benign Het
Other mutations in Gad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Gad2 APN 2 22685386 missense probably benign 0.07
IGL00870:Gad2 APN 2 22629971 missense probably benign 0.42
IGL01142:Gad2 APN 2 22681285 splice site probably benign
IGL01577:Gad2 APN 2 22681280 splice site probably benign
IGL01671:Gad2 APN 2 22623699 nonsense probably null
IGL02346:Gad2 APN 2 22629939 splice site probably benign
IGL02348:Gad2 APN 2 22629393 missense probably damaging 1.00
IGL03113:Gad2 APN 2 22681355 missense probably benign 0.09
gruene UTSW 2 22685067 critical splice donor site probably null
Mosey UTSW 2 22668257 missense probably damaging 1.00
R0630:Gad2 UTSW 2 22690336 missense probably benign 0.14
R1109:Gad2 UTSW 2 22681394 missense probably damaging 1.00
R1109:Gad2 UTSW 2 22690159 splice site probably benign
R1122:Gad2 UTSW 2 22623451 missense possibly damaging 0.68
R1773:Gad2 UTSW 2 22690207 missense probably benign
R1895:Gad2 UTSW 2 22685428 missense probably benign
R1946:Gad2 UTSW 2 22685428 missense probably benign
R2329:Gad2 UTSW 2 22668289 missense probably damaging 1.00
R2857:Gad2 UTSW 2 22673975 missense probably benign 0.02
R3754:Gad2 UTSW 2 22681340 missense possibly damaging 0.91
R3847:Gad2 UTSW 2 22684988 missense probably benign 0.00
R4382:Gad2 UTSW 2 22685410 missense probably benign
R4383:Gad2 UTSW 2 22685410 missense probably benign
R4384:Gad2 UTSW 2 22685410 missense probably benign
R4651:Gad2 UTSW 2 22668362 missense probably damaging 1.00
R4700:Gad2 UTSW 2 22673970 missense probably damaging 1.00
R4766:Gad2 UTSW 2 22622667 missense probably damaging 0.99
R5279:Gad2 UTSW 2 22673957 missense probably benign 0.38
R5372:Gad2 UTSW 2 22690243 missense possibly damaging 0.84
R5505:Gad2 UTSW 2 22624833 missense probably benign
R5820:Gad2 UTSW 2 22690249 missense probably benign 0.00
R5868:Gad2 UTSW 2 22685067 critical splice donor site probably null
R6026:Gad2 UTSW 2 22623736 missense probably benign 0.00
R6497:Gad2 UTSW 2 22668257 missense probably damaging 1.00
R6675:Gad2 UTSW 2 22673985 missense possibly damaging 0.67
R7157:Gad2 UTSW 2 22635023 missense probably damaging 0.98
R7352:Gad2 UTSW 2 22623823 missense probably benign 0.00
R7951:Gad2 UTSW 2 22623487 missense probably damaging 0.96
R8285:Gad2 UTSW 2 22624928 missense probably benign 0.45
X0019:Gad2 UTSW 2 22690172 critical splice acceptor site probably null
Z1177:Gad2 UTSW 2 22635014 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAACGAAAATTCTCACTCGCCC -3'
(R):5'- GGAAATTTGTGCTACTCAGAGGCTTGG -3'

Sequencing Primer
(F):5'- GTGGCCCAAAAGTTCACG -3'
(R):5'- CCTCCAACTATCGAGGCTG -3'
Posted On2014-04-24