Incidental Mutation 'R1604:Lrguk'
ID 176328
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 039641-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R1604 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 34006379-34110969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34049305 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 341 (T341A)
Ref Sequence ENSEMBL: ENSMUSP00000153993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
AlphaFold Q9D5S7
Predicted Effect probably benign
Transcript: ENSMUST00000070189
AA Change: T341A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: T341A

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228187
AA Change: T341A

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,612,405 (GRCm39) D110G probably damaging Het
Angptl2 T C 2: 33,133,785 (GRCm39) M369T possibly damaging Het
Anks3 C T 16: 4,766,117 (GRCm39) V151M probably damaging Het
Arl6ip6 T C 2: 53,082,508 (GRCm39) L125P probably damaging Het
Bmp1 T C 14: 70,745,444 (GRCm39) Q247R possibly damaging Het
Ccdc30 A G 4: 119,188,793 (GRCm39) I491T probably damaging Het
Cdhr1 T A 14: 36,817,050 (GRCm39) I104F probably benign Het
Cdk17 G T 10: 93,068,360 (GRCm39) M372I probably damaging Het
Cyp2c54 A G 19: 40,058,787 (GRCm39) V215A probably benign Het
D430041D05Rik T A 2: 104,035,487 (GRCm39) I1614F probably damaging Het
Ddx55 A G 5: 124,697,369 (GRCm39) N244D probably damaging Het
Dop1b G T 16: 93,559,458 (GRCm39) V617F probably benign Het
Erbb4 G T 1: 68,385,728 (GRCm39) A287E possibly damaging Het
Fmnl2 A G 2: 52,995,549 (GRCm39) E424G probably damaging Het
Gad2 T C 2: 22,513,852 (GRCm39) probably null Het
Gm17421 G A 12: 113,333,155 (GRCm39) noncoding transcript Het
Gm9894 T A 13: 67,913,008 (GRCm39) noncoding transcript Het
Gnpat T C 8: 125,603,700 (GRCm39) S193P probably damaging Het
Gpr20 C T 15: 73,567,853 (GRCm39) V179M probably damaging Het
Hdgf T A 3: 87,821,347 (GRCm39) probably null Het
Itgb8 A T 12: 119,166,265 (GRCm39) L89M probably damaging Het
Lnx2 T C 5: 146,966,135 (GRCm39) D328G probably benign Het
Map1b A G 13: 99,566,080 (GRCm39) S2214P unknown Het
Mms22l T C 4: 24,502,804 (GRCm39) F131L probably damaging Het
Msmo1 A G 8: 65,180,689 (GRCm39) I75T probably damaging Het
Or10d1c A T 9: 38,893,914 (GRCm39) M142K probably benign Het
Or2a56 G A 6: 42,932,650 (GRCm39) A73T possibly damaging Het
Or51k1 G T 7: 103,661,162 (GRCm39) A249E probably damaging Het
Or8c13 A G 9: 38,091,645 (GRCm39) V158A probably benign Het
Or8d2 T G 9: 38,760,000 (GRCm39) F197V probably benign Het
Pkhd1l1 C T 15: 44,330,763 (GRCm39) R113* probably null Het
Polr2m T C 9: 71,390,959 (GRCm39) D81G probably damaging Het
Ppp1r15b T A 1: 133,060,287 (GRCm39) M268K probably benign Het
Ptprcap T A 19: 4,206,073 (GRCm39) L52* probably null Het
Rasgrp2 C T 19: 6,457,087 (GRCm39) T277I possibly damaging Het
Rrbp1 T C 2: 143,831,310 (GRCm39) N286D probably damaging Het
Scml2 G T X: 160,014,442 (GRCm39) E566D possibly damaging Het
Scrib A C 15: 75,920,089 (GRCm39) S1557A probably damaging Het
Sergef C A 7: 46,092,783 (GRCm39) V409L probably benign Het
Shisal1 T C 15: 84,290,672 (GRCm39) M212V probably benign Het
Slc6a13 A G 6: 121,309,328 (GRCm39) M280V probably benign Het
Slc9a8 C T 2: 167,313,352 (GRCm39) P409S probably benign Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,612,239 (GRCm39) probably benign Het
Spc25 T C 2: 69,035,498 (GRCm39) D4G probably damaging Het
Specc1 C T 11: 61,933,883 (GRCm39) R88C probably damaging Het
Srsf11 C T 3: 157,724,948 (GRCm39) probably null Het
Stt3b T C 9: 115,079,995 (GRCm39) E639G probably damaging Het
Sult3a1 A C 10: 33,742,616 (GRCm39) E81A probably damaging Het
Taf1b G A 12: 24,606,623 (GRCm39) G481D probably benign Het
Tgm4 T C 9: 122,874,129 (GRCm39) V123A probably benign Het
Tie1 G T 4: 118,331,604 (GRCm39) H973N probably damaging Het
Tmem117 C T 15: 94,992,425 (GRCm39) R362W probably damaging Het
Txnip A T 3: 96,466,277 (GRCm39) Q107L probably benign Het
Ubap2 C T 4: 41,199,872 (GRCm39) A752T probably benign Het
Vcan A G 13: 89,837,780 (GRCm39) V1628A probably benign Het
Vmn2r115 T A 17: 23,564,245 (GRCm39) M139K probably benign Het
Wwp1 A G 4: 19,659,709 (GRCm39) V193A probably benign Het
Zcchc8 C T 5: 123,838,721 (GRCm39) A606T probably benign Het
Zfp131 G A 13: 120,230,316 (GRCm39) L371F probably damaging Het
Zfp518b T C 5: 38,830,949 (GRCm39) D352G probably damaging Het
Zfp784 A G 7: 5,039,453 (GRCm39) probably benign Het
Zfp940 A T 7: 29,545,500 (GRCm39) F136I probably benign Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34,020,364 (GRCm39) missense probably damaging 1.00
IGL00566:Lrguk APN 6 34,033,109 (GRCm39) missense probably damaging 1.00
IGL01720:Lrguk APN 6 34,020,412 (GRCm39) missense probably damaging 1.00
IGL02325:Lrguk APN 6 34,106,114 (GRCm39) missense probably benign 0.31
IGL02484:Lrguk APN 6 34,069,726 (GRCm39) missense probably damaging 1.00
IGL02493:Lrguk APN 6 34,106,127 (GRCm39) missense probably benign 0.03
IGL02636:Lrguk APN 6 34,067,123 (GRCm39) missense probably damaging 1.00
IGL03278:Lrguk APN 6 34,093,381 (GRCm39) missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34,020,431 (GRCm39) missense probably damaging 0.99
R1069:Lrguk UTSW 6 34,025,818 (GRCm39) missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34,039,295 (GRCm39) missense probably benign 0.01
R1568:Lrguk UTSW 6 34,063,373 (GRCm39) missense probably damaging 1.00
R1847:Lrguk UTSW 6 34,110,322 (GRCm39) missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34,048,003 (GRCm39) missense probably damaging 1.00
R2107:Lrguk UTSW 6 34,039,296 (GRCm39) missense probably benign 0.15
R2125:Lrguk UTSW 6 34,069,837 (GRCm39) missense probably benign 0.05
R2136:Lrguk UTSW 6 34,020,454 (GRCm39) missense probably benign 0.00
R2997:Lrguk UTSW 6 34,050,697 (GRCm39) missense probably damaging 0.98
R3847:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R3849:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R4626:Lrguk UTSW 6 34,106,158 (GRCm39) missense probably benign 0.00
R4718:Lrguk UTSW 6 34,006,431 (GRCm39) missense probably benign 0.02
R4778:Lrguk UTSW 6 34,033,015 (GRCm39) missense probably damaging 1.00
R4841:Lrguk UTSW 6 34,069,802 (GRCm39) missense probably damaging 0.98
R5324:Lrguk UTSW 6 34,050,732 (GRCm39) missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34,047,996 (GRCm39) missense probably damaging 1.00
R5741:Lrguk UTSW 6 34,025,802 (GRCm39) missense probably damaging 0.99
R5939:Lrguk UTSW 6 34,055,688 (GRCm39) missense probably damaging 1.00
R5997:Lrguk UTSW 6 34,106,078 (GRCm39) missense probably damaging 0.99
R6786:Lrguk UTSW 6 34,072,522 (GRCm39) missense probably benign 0.11
R6802:Lrguk UTSW 6 34,039,392 (GRCm39) missense probably damaging 1.00
R7081:Lrguk UTSW 6 34,079,074 (GRCm39) missense probably benign 0.01
R7303:Lrguk UTSW 6 34,006,411 (GRCm39) missense probably benign 0.00
R7316:Lrguk UTSW 6 34,080,191 (GRCm39) missense unknown
R7473:Lrguk UTSW 6 34,006,630 (GRCm39) missense probably benign 0.01
R7543:Lrguk UTSW 6 34,025,870 (GRCm39) nonsense probably null
R7613:Lrguk UTSW 6 34,078,683 (GRCm39) missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34,072,474 (GRCm39) missense probably damaging 1.00
R7900:Lrguk UTSW 6 34,106,129 (GRCm39) missense probably benign 0.01
R8012:Lrguk UTSW 6 34,033,038 (GRCm39) missense probably benign 0.00
R8251:Lrguk UTSW 6 34,093,374 (GRCm39) missense probably benign 0.00
R8324:Lrguk UTSW 6 34,079,506 (GRCm39) missense probably benign 0.03
R8551:Lrguk UTSW 6 34,093,446 (GRCm39) missense probably damaging 0.96
R8828:Lrguk UTSW 6 34,080,572 (GRCm39) missense unknown
R8879:Lrguk UTSW 6 34,006,618 (GRCm39) missense probably benign 0.00
X0057:Lrguk UTSW 6 34,055,682 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- ACCAGAGGATAATCCTGCCTTCCC -3'
(R):5'- TGTCCTGCTGTAAGCACCTGACAC -3'

Sequencing Primer
(F):5'- ACAGGACACATTCTGTAGCTTGG -3'
(R):5'- GCTGTAAGCACCTGACACTTTTG -3'
Posted On 2014-04-24