Mutagenetix > Incidental Mutations

Incidental Mutation 'R1604:Specc1'

176347

Institutional Source

Beutler Lab

Gene Symbol

Specc1

Ensembl Gene

ENSMUSG00000042331

Gene Name

sperm antigen with calponin homology and coiled-coil domains 1

Synonyms

Cytsb

MMRRC Submission

039641-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.157) question?

Stock #

R1604 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

61956763-62223013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 62043057 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 88 (R88C)

Ref Sequence

ENSEMBL: ENSMUSP00000144161 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049836] [ENSMUST00000108709] [ENSMUST00000201364] [ENSMUST00000201624] [ENSMUST00000201671] [ENSMUST00000202178] [ENSMUST00000202389] [ENSMUST00000202905]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049836
AA Change: R88C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000063102
Gene: ENSMUSG00000042331
AA Change: R88C

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108709
AA Change: R88C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104349
Gene: ENSMUSG00000042331
AA Change: R88C

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
low complexity region	912	924	N/A	INTRINSIC
CH	963	1061	2.69e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136971

Predicted Effect

probably damaging
Transcript: ENSMUST00000201364
AA Change: R88C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000143853
Gene: ENSMUSG00000042331
AA Change: R88C

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
CH	954	1052	2.69e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000201624
AA Change: R88C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144659
Gene: ENSMUSG00000042331
AA Change: R88C

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000201671
AA Change: R88C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144030
Gene: ENSMUSG00000042331
AA Change: R88C

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201866

Predicted Effect

probably damaging
Transcript: ENSMUST00000202178
AA Change: R88C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144161
Gene: ENSMUSG00000042331
AA Change: R88C

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202389
AA Change: R88C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144055
Gene: ENSMUSG00000042331
AA Change: R88C

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
low complexity region	912	924	N/A	INTRINSIC
CH	963	1061	2.69e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202869

Predicted Effect

probably damaging
Transcript: ENSMUST00000202905
AA Change: R88C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144311
Gene: ENSMUSG00000042331
AA Change: R88C

Domain	Start	End	E-Value	Type
low complexity region	26	40	N/A	INTRINSIC
low complexity region	123	143	N/A	INTRINSIC
coiled coil region	159	196	N/A	INTRINSIC
coiled coil region	224	259	N/A	INTRINSIC
low complexity region	311	316	N/A	INTRINSIC
coiled coil region	362	454	N/A	INTRINSIC
coiled coil region	479	520	N/A	INTRINSIC
coiled coil region	575	773	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
low complexity region	912	924	N/A	INTRINSIC
CH	963	1061	2.69e-16	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cytospin-A family. It is localized in the nucleus, and highly expressed in testis and some cancer cell lines. A chromosomal translocation involving this gene and platelet-derived growth factor receptor, beta gene (PDGFRB) may be a cause of juvenile myelomonocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	T	C	15: 84,406,471	M212V	probably benign	Het
Aldoart2	A	G	12: 55,565,620	D110G	probably damaging	Het
Angptl2	T	C	2: 33,243,773	M369T	possibly damaging	Het
Anks3	C	T	16: 4,948,253	V151M	probably damaging	Het
Arl6ip6	T	C	2: 53,192,496	L125P	probably damaging	Het
Bmp1	T	C	14: 70,508,004	Q247R	possibly damaging	Het
Ccdc30	A	G	4: 119,331,596	I491T	probably damaging	Het
Cdhr1	T	A	14: 37,095,093	I104F	probably benign	Het
Cdk17	G	T	10: 93,232,498	M372I	probably damaging	Het
Cyp2c54	A	G	19: 40,070,343	V215A	probably benign	Het
D430041D05Rik	T	A	2: 104,205,142	I1614F	probably damaging	Het
Ddx55	A	G	5: 124,559,306	N244D	probably damaging	Het
Dopey2	G	T	16: 93,762,570	V617F	probably benign	Het
Erbb4	G	T	1: 68,346,569	A287E	possibly damaging	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Gad2	T	C	2: 22,623,840		probably null	Het
Gm17421	G	A	12: 113,369,535		noncoding transcript	Het
Gm9894	T	A	13: 67,764,889		noncoding transcript	Het
Gnpat	T	C	8: 124,876,961	S193P	probably damaging	Het
Gpr20	C	T	15: 73,696,004	V179M	probably damaging	Het
Hdgf	T	A	3: 87,914,040		probably null	Het
Itgb8	A	T	12: 119,202,530	L89M	probably damaging	Het
Lnx2	T	C	5: 147,029,325	D328G	probably benign	Het
Lrguk	A	G	6: 34,072,370	T341A	possibly damaging	Het
Map1b	A	G	13: 99,429,572	S2214P	unknown	Het
Mms22l	T	C	4: 24,502,804	F131L	probably damaging	Het
Msmo1	A	G	8: 64,727,655	I75T	probably damaging	Het
Olfr444	G	A	6: 42,955,716	A73T	possibly damaging	Het
Olfr639	G	T	7: 104,011,955	A249E	probably damaging	Het
Olfr891	A	G	9: 38,180,349	V158A	probably benign	Het
Olfr924	T	G	9: 38,848,704	F197V	probably benign	Het
Olfr934	A	T	9: 38,982,618	M142K	probably benign	Het
Pkhd1l1	C	T	15: 44,467,367	R113*	probably null	Het
Polr2m	T	C	9: 71,483,677	D81G	probably damaging	Het
Ppp1r15b	T	A	1: 133,132,549	M268K	probably benign	Het
Ptprcap	T	A	19: 4,156,074	L52*	probably null	Het
Rasgrp2	C	T	19: 6,407,057	T277I	possibly damaging	Het
Rrbp1	T	C	2: 143,989,390	N286D	probably damaging	Het
Scml2	G	T	X: 161,231,446	E566D	possibly damaging	Het
Scrib	A	C	15: 76,048,240	S1557A	probably damaging	Het
Sergef	C	A	7: 46,443,359	V409L	probably benign	Het
Slc6a13	A	G	6: 121,332,369	M280V	probably benign	Het
Slc9a8	C	T	2: 167,471,432	P409S	probably benign	Het
Smarca4	CGAGGAGGAGGAGGAGG	CGAGGAGGAGGAGG	9: 21,700,943		probably benign	Het
Spc25	T	C	2: 69,205,154	D4G	probably damaging	Het
Srsf11	C	T	3: 158,019,311		probably null	Het
Stt3b	T	C	9: 115,250,927	E639G	probably damaging	Het
Sult3a1	A	C	10: 33,866,620	E81A	probably damaging	Het
Taf1b	G	A	12: 24,556,624	G481D	probably benign	Het
Tgm4	T	C	9: 123,045,064	V123A	probably benign	Het
Tie1	G	T	4: 118,474,407	H973N	probably damaging	Het
Tmem117	C	T	15: 95,094,544	R362W	probably damaging	Het
Txnip	A	T	3: 96,558,961	Q107L	probably benign	Het
Ubap2	C	T	4: 41,199,872	A752T	probably benign	Het
Vcan	A	G	13: 89,689,661	V1628A	probably benign	Het
Vmn2r115	T	A	17: 23,345,271	M139K	probably benign	Het
Wwp1	A	G	4: 19,659,709	V193A	probably benign	Het
Zcchc8	C	T	5: 123,700,658	A606T	probably benign	Het
Zfp131	G	A	13: 119,768,780	L371F	probably damaging	Het
Zfp518b	T	C	5: 38,673,606	D352G	probably damaging	Het
Zfp784	A	G	7: 5,036,454		probably benign	Het
Zfp940	A	T	7: 29,846,075	F136I	probably benign	Het

Other mutations in Specc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Specc1	APN	11	62118009	missense	probably benign	0.02
IGL01953:Specc1	APN	11	62118296	missense	probably benign	0.40
IGL02244:Specc1	APN	11	62128368	missense	probably benign	0.41
IGL02257:Specc1	APN	11	62118417	missense	probably damaging	1.00
IGL02512:Specc1	APN	11	62118389	missense	probably damaging	1.00
IGL03147:Specc1	UTSW	11	62118282	missense	probably benign
R0039:Specc1	UTSW	11	62029369	missense	probably damaging	0.97
R0114:Specc1	UTSW	11	62146313	missense	possibly damaging	0.92
R0635:Specc1	UTSW	11	62118903	missense	probably damaging	1.00
R1514:Specc1	UTSW	11	62156532	missense	probably damaging	1.00
R1717:Specc1	UTSW	11	62128392	missense	possibly damaging	0.88
R1719:Specc1	UTSW	11	62128392	missense	possibly damaging	0.88
R1739:Specc1	UTSW	11	62118818	nonsense	probably null
R1757:Specc1	UTSW	11	62119284	critical splice donor site	probably null
R1990:Specc1	UTSW	11	62029294	missense	possibly damaging	0.87
R1991:Specc1	UTSW	11	62029294	missense	possibly damaging	0.87
R2063:Specc1	UTSW	11	62118296	missense	probably benign	0.01
R2071:Specc1	UTSW	11	62117875	missense	probably damaging	0.98
R2245:Specc1	UTSW	11	62131887	missense	probably damaging	1.00
R3415:Specc1	UTSW	11	62118419	missense	probably benign	0.29
R3831:Specc1	UTSW	11	62117967	missense	probably damaging	1.00
R3890:Specc1	UTSW	11	62151913	missense	probably benign	0.00
R3891:Specc1	UTSW	11	62151913	missense	probably benign	0.00
R4367:Specc1	UTSW	11	62118530	missense	probably damaging	1.00
R4489:Specc1	UTSW	11	62151827	splice site	probably null
R4580:Specc1	UTSW	11	62219331	missense	probably damaging	1.00
R4852:Specc1	UTSW	11	62211684	missense	probably damaging	1.00
R4930:Specc1	UTSW	11	62118958	missense	possibly damaging	0.93
R5016:Specc1	UTSW	11	62118957	missense	possibly damaging	0.92
R5416:Specc1	UTSW	11	62118909	missense	probably benign	0.00
R5650:Specc1	UTSW	11	62117967	missense	probably damaging	1.00
R6158:Specc1	UTSW	11	62118124	missense	probably damaging	0.99
R6329:Specc1	UTSW	11	62156553	missense	probably damaging	1.00
R6374:Specc1	UTSW	11	62156592	missense	possibly damaging	0.93
R6395:Specc1	UTSW	11	62132338	missense	probably damaging	1.00
R6653:Specc1	UTSW	11	62146418	missense	probably damaging	0.99
R6893:Specc1	UTSW	11	62132453	missense	probably benign
R6898:Specc1	UTSW	11	62118336	missense	probably benign
R7054:Specc1	UTSW	11	62117778	missense	probably damaging	0.96
R7294:Specc1	UTSW	11	62118337	missense	probably benign	0.01
R7376:Specc1	UTSW	11	62118252	missense	probably benign	0.06
R7560:Specc1	UTSW	11	62128409	critical splice donor site	probably null
R7605:Specc1	UTSW	11	62211680	missense	possibly damaging	0.91
R7621:Specc1	UTSW	11	62128384	missense	possibly damaging	0.96
R7804:Specc1	UTSW	11	62205397	missense	probably damaging	0.99
R7900:Specc1	UTSW	11	62219361	missense	probably damaging	1.00
R8310:Specc1	UTSW	11	62132345	missense	probably damaging	1.00
R8319:Specc1	UTSW	11	62118675	missense	possibly damaging	0.77
Z1177:Specc1	UTSW	11	62118767	missense	possibly damaging	0.86
Z1177:Specc1	UTSW	11	62205423	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- GCATTGAGTTCCTCACCGTGTCTG -3'
(R):5'- ACGATCCACTGCCATCATTGCC -3'

Sequencing Primer
(F):5'- GTGTCTGCCCTCTCAGC -3'
(R):5'- cacacacacacacacgaac -3'

Posted On

2014-04-24