Incidental Mutation 'R1604:Anks3'
ID176364
Institutional Source Beutler Lab
Gene Symbol Anks3
Ensembl Gene ENSMUSG00000022515
Gene Nameankyrin repeat and sterile alpha motif domain containing 3
Synonyms2700067D09Rik
MMRRC Submission 039641-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1604 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location4941436-4964205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4948253 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 151 (V151M)
Ref Sequence ENSEMBL: ENSMUSP00000155720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023157] [ENSMUST00000229017] [ENSMUST00000229765]
Predicted Effect probably damaging
Transcript: ENSMUST00000023157
AA Change: V326M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023157
Gene: ENSMUSG00000022515
AA Change: V326M

DomainStartEndE-ValueType
ANK 34 64 1.25e2 SMART
ANK 68 97 9.93e-5 SMART
ANK 101 130 9.13e-4 SMART
ANK 134 163 2.45e-4 SMART
ANK 168 197 9.27e-5 SMART
ANK 201 230 5.87e2 SMART
SAM 421 487 9.8e-12 SMART
coiled coil region 500 533 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229017
AA Change: V151M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect unknown
Transcript: ENSMUST00000229272
AA Change: V30M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229477
Predicted Effect probably damaging
Transcript: ENSMUST00000229765
AA Change: V326M

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230493
Predicted Effect probably benign
Transcript: ENSMUST00000231036
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T C 15: 84,406,471 M212V probably benign Het
Aldoart2 A G 12: 55,565,620 D110G probably damaging Het
Angptl2 T C 2: 33,243,773 M369T possibly damaging Het
Arl6ip6 T C 2: 53,192,496 L125P probably damaging Het
Bmp1 T C 14: 70,508,004 Q247R possibly damaging Het
Ccdc30 A G 4: 119,331,596 I491T probably damaging Het
Cdhr1 T A 14: 37,095,093 I104F probably benign Het
Cdk17 G T 10: 93,232,498 M372I probably damaging Het
Cyp2c54 A G 19: 40,070,343 V215A probably benign Het
D430041D05Rik T A 2: 104,205,142 I1614F probably damaging Het
Ddx55 A G 5: 124,559,306 N244D probably damaging Het
Dopey2 G T 16: 93,762,570 V617F probably benign Het
Erbb4 G T 1: 68,346,569 A287E possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gad2 T C 2: 22,623,840 probably null Het
Gm17421 G A 12: 113,369,535 noncoding transcript Het
Gm9894 T A 13: 67,764,889 noncoding transcript Het
Gnpat T C 8: 124,876,961 S193P probably damaging Het
Gpr20 C T 15: 73,696,004 V179M probably damaging Het
Hdgf T A 3: 87,914,040 probably null Het
Itgb8 A T 12: 119,202,530 L89M probably damaging Het
Lnx2 T C 5: 147,029,325 D328G probably benign Het
Lrguk A G 6: 34,072,370 T341A possibly damaging Het
Map1b A G 13: 99,429,572 S2214P unknown Het
Mms22l T C 4: 24,502,804 F131L probably damaging Het
Msmo1 A G 8: 64,727,655 I75T probably damaging Het
Olfr444 G A 6: 42,955,716 A73T possibly damaging Het
Olfr639 G T 7: 104,011,955 A249E probably damaging Het
Olfr891 A G 9: 38,180,349 V158A probably benign Het
Olfr924 T G 9: 38,848,704 F197V probably benign Het
Olfr934 A T 9: 38,982,618 M142K probably benign Het
Pkhd1l1 C T 15: 44,467,367 R113* probably null Het
Polr2m T C 9: 71,483,677 D81G probably damaging Het
Ppp1r15b T A 1: 133,132,549 M268K probably benign Het
Ptprcap T A 19: 4,156,074 L52* probably null Het
Rasgrp2 C T 19: 6,407,057 T277I possibly damaging Het
Rrbp1 T C 2: 143,989,390 N286D probably damaging Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Scrib A C 15: 76,048,240 S1557A probably damaging Het
Sergef C A 7: 46,443,359 V409L probably benign Het
Slc6a13 A G 6: 121,332,369 M280V probably benign Het
Slc9a8 C T 2: 167,471,432 P409S probably benign Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Spc25 T C 2: 69,205,154 D4G probably damaging Het
Specc1 C T 11: 62,043,057 R88C probably damaging Het
Srsf11 C T 3: 158,019,311 probably null Het
Stt3b T C 9: 115,250,927 E639G probably damaging Het
Sult3a1 A C 10: 33,866,620 E81A probably damaging Het
Taf1b G A 12: 24,556,624 G481D probably benign Het
Tgm4 T C 9: 123,045,064 V123A probably benign Het
Tie1 G T 4: 118,474,407 H973N probably damaging Het
Tmem117 C T 15: 95,094,544 R362W probably damaging Het
Txnip A T 3: 96,558,961 Q107L probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Vcan A G 13: 89,689,661 V1628A probably benign Het
Vmn2r115 T A 17: 23,345,271 M139K probably benign Het
Wwp1 A G 4: 19,659,709 V193A probably benign Het
Zcchc8 C T 5: 123,700,658 A606T probably benign Het
Zfp131 G A 13: 119,768,780 L371F probably damaging Het
Zfp518b T C 5: 38,673,606 D352G probably damaging Het
Zfp784 A G 7: 5,036,454 probably benign Het
Zfp940 A T 7: 29,846,075 F136I probably benign Het
Other mutations in Anks3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Anks3 APN 16 4953929 missense possibly damaging 0.93
IGL01705:Anks3 APN 16 4947723 missense probably benign 0.00
IGL01953:Anks3 APN 16 4960544 missense probably damaging 1.00
IGL02378:Anks3 APN 16 4950762 missense possibly damaging 0.91
IGL03126:Anks3 APN 16 4958027 missense probably damaging 1.00
R0051:Anks3 UTSW 16 4947749 missense probably benign 0.16
R0051:Anks3 UTSW 16 4947749 missense probably benign 0.16
R0661:Anks3 UTSW 16 4948334 missense probably damaging 1.00
R0855:Anks3 UTSW 16 4955947 splice site probably benign
R0932:Anks3 UTSW 16 4953827 missense probably damaging 1.00
R1773:Anks3 UTSW 16 4947294 missense probably benign
R1846:Anks3 UTSW 16 4953884 missense probably benign 0.07
R1928:Anks3 UTSW 16 4946054 critical splice donor site probably null
R2323:Anks3 UTSW 16 4950770 critical splice acceptor site probably null
R3916:Anks3 UTSW 16 4947279 missense probably damaging 0.97
R5597:Anks3 UTSW 16 4953929 missense possibly damaging 0.93
R5993:Anks3 UTSW 16 4958137 missense probably damaging 1.00
R7345:Anks3 UTSW 16 4955910 missense possibly damaging 0.88
R7373:Anks3 UTSW 16 4955871 missense probably benign 0.00
Z1176:Anks3 UTSW 16 4950714 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTGAGTACTGTGTGCCTCATCAACC -3'
(R):5'- CGCTCATGTCCCGTGATGTACAAG -3'

Sequencing Primer
(F):5'- CTGTGGGACCTCCAGAATC -3'
(R):5'- CCATGTTACTATGCAAGGAGATG -3'
Posted On2014-04-24