Incidental Mutation 'R1604:Cyp2c54'
ID 176370
Institutional Source Beutler Lab
Gene Symbol Cyp2c54
Ensembl Gene ENSMUSG00000067225
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 54
Synonyms
MMRRC Submission 039641-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R1604 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 40026384-40062271 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40058787 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 215 (V215A)
Ref Sequence ENSEMBL: ENSMUSP00000048284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048959]
AlphaFold Q6XVG2
Predicted Effect probably benign
Transcript: ENSMUST00000048959
AA Change: V215A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000048284
Gene: ENSMUSG00000067225
AA Change: V215A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 2.2e-159 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,612,405 (GRCm39) D110G probably damaging Het
Angptl2 T C 2: 33,133,785 (GRCm39) M369T possibly damaging Het
Anks3 C T 16: 4,766,117 (GRCm39) V151M probably damaging Het
Arl6ip6 T C 2: 53,082,508 (GRCm39) L125P probably damaging Het
Bmp1 T C 14: 70,745,444 (GRCm39) Q247R possibly damaging Het
Ccdc30 A G 4: 119,188,793 (GRCm39) I491T probably damaging Het
Cdhr1 T A 14: 36,817,050 (GRCm39) I104F probably benign Het
Cdk17 G T 10: 93,068,360 (GRCm39) M372I probably damaging Het
D430041D05Rik T A 2: 104,035,487 (GRCm39) I1614F probably damaging Het
Ddx55 A G 5: 124,697,369 (GRCm39) N244D probably damaging Het
Dop1b G T 16: 93,559,458 (GRCm39) V617F probably benign Het
Erbb4 G T 1: 68,385,728 (GRCm39) A287E possibly damaging Het
Fmnl2 A G 2: 52,995,549 (GRCm39) E424G probably damaging Het
Gad2 T C 2: 22,513,852 (GRCm39) probably null Het
Gm17421 G A 12: 113,333,155 (GRCm39) noncoding transcript Het
Gm9894 T A 13: 67,913,008 (GRCm39) noncoding transcript Het
Gnpat T C 8: 125,603,700 (GRCm39) S193P probably damaging Het
Gpr20 C T 15: 73,567,853 (GRCm39) V179M probably damaging Het
Hdgf T A 3: 87,821,347 (GRCm39) probably null Het
Itgb8 A T 12: 119,166,265 (GRCm39) L89M probably damaging Het
Lnx2 T C 5: 146,966,135 (GRCm39) D328G probably benign Het
Lrguk A G 6: 34,049,305 (GRCm39) T341A possibly damaging Het
Map1b A G 13: 99,566,080 (GRCm39) S2214P unknown Het
Mms22l T C 4: 24,502,804 (GRCm39) F131L probably damaging Het
Msmo1 A G 8: 65,180,689 (GRCm39) I75T probably damaging Het
Or10d1c A T 9: 38,893,914 (GRCm39) M142K probably benign Het
Or2a56 G A 6: 42,932,650 (GRCm39) A73T possibly damaging Het
Or51k1 G T 7: 103,661,162 (GRCm39) A249E probably damaging Het
Or8c13 A G 9: 38,091,645 (GRCm39) V158A probably benign Het
Or8d2 T G 9: 38,760,000 (GRCm39) F197V probably benign Het
Pkhd1l1 C T 15: 44,330,763 (GRCm39) R113* probably null Het
Polr2m T C 9: 71,390,959 (GRCm39) D81G probably damaging Het
Ppp1r15b T A 1: 133,060,287 (GRCm39) M268K probably benign Het
Ptprcap T A 19: 4,206,073 (GRCm39) L52* probably null Het
Rasgrp2 C T 19: 6,457,087 (GRCm39) T277I possibly damaging Het
Rrbp1 T C 2: 143,831,310 (GRCm39) N286D probably damaging Het
Scml2 G T X: 160,014,442 (GRCm39) E566D possibly damaging Het
Scrib A C 15: 75,920,089 (GRCm39) S1557A probably damaging Het
Sergef C A 7: 46,092,783 (GRCm39) V409L probably benign Het
Shisal1 T C 15: 84,290,672 (GRCm39) M212V probably benign Het
Slc6a13 A G 6: 121,309,328 (GRCm39) M280V probably benign Het
Slc9a8 C T 2: 167,313,352 (GRCm39) P409S probably benign Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,612,239 (GRCm39) probably benign Het
Spc25 T C 2: 69,035,498 (GRCm39) D4G probably damaging Het
Specc1 C T 11: 61,933,883 (GRCm39) R88C probably damaging Het
Srsf11 C T 3: 157,724,948 (GRCm39) probably null Het
Stt3b T C 9: 115,079,995 (GRCm39) E639G probably damaging Het
Sult3a1 A C 10: 33,742,616 (GRCm39) E81A probably damaging Het
Taf1b G A 12: 24,606,623 (GRCm39) G481D probably benign Het
Tgm4 T C 9: 122,874,129 (GRCm39) V123A probably benign Het
Tie1 G T 4: 118,331,604 (GRCm39) H973N probably damaging Het
Tmem117 C T 15: 94,992,425 (GRCm39) R362W probably damaging Het
Txnip A T 3: 96,466,277 (GRCm39) Q107L probably benign Het
Ubap2 C T 4: 41,199,872 (GRCm39) A752T probably benign Het
Vcan A G 13: 89,837,780 (GRCm39) V1628A probably benign Het
Vmn2r115 T A 17: 23,564,245 (GRCm39) M139K probably benign Het
Wwp1 A G 4: 19,659,709 (GRCm39) V193A probably benign Het
Zcchc8 C T 5: 123,838,721 (GRCm39) A606T probably benign Het
Zfp131 G A 13: 120,230,316 (GRCm39) L371F probably damaging Het
Zfp518b T C 5: 38,830,949 (GRCm39) D352G probably damaging Het
Zfp784 A G 7: 5,039,453 (GRCm39) probably benign Het
Zfp940 A T 7: 29,545,500 (GRCm39) F136I probably benign Het
Other mutations in Cyp2c54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Cyp2c54 APN 19 40,060,522 (GRCm39) missense probably damaging 1.00
IGL02694:Cyp2c54 APN 19 40,035,987 (GRCm39) missense possibly damaging 0.55
IGL03170:Cyp2c54 APN 19 40,060,809 (GRCm39) critical splice donor site probably null
IGL03175:Cyp2c54 APN 19 40,058,672 (GRCm39) missense probably benign 0.00
R0097:Cyp2c54 UTSW 19 40,036,103 (GRCm39) splice site probably benign
R0097:Cyp2c54 UTSW 19 40,036,102 (GRCm39) splice site probably benign
R0391:Cyp2c54 UTSW 19 40,060,613 (GRCm39) missense possibly damaging 0.61
R0581:Cyp2c54 UTSW 19 40,035,999 (GRCm39) missense probably benign 0.23
R0787:Cyp2c54 UTSW 19 40,036,079 (GRCm39) missense probably benign 0.12
R1253:Cyp2c54 UTSW 19 40,034,629 (GRCm39) missense probably damaging 1.00
R1481:Cyp2c54 UTSW 19 40,036,032 (GRCm39) missense probably benign 0.30
R3624:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R3871:Cyp2c54 UTSW 19 40,060,867 (GRCm39) missense probably benign 0.37
R3983:Cyp2c54 UTSW 19 40,034,699 (GRCm39) missense possibly damaging 0.49
R4401:Cyp2c54 UTSW 19 40,060,615 (GRCm39) missense probably benign 0.04
R4416:Cyp2c54 UTSW 19 40,026,703 (GRCm39) missense probably benign 0.04
R4962:Cyp2c54 UTSW 19 40,060,585 (GRCm39) missense possibly damaging 0.90
R5203:Cyp2c54 UTSW 19 40,060,918 (GRCm39) missense probably damaging 1.00
R5634:Cyp2c54 UTSW 19 40,060,858 (GRCm39) missense possibly damaging 0.84
R6083:Cyp2c54 UTSW 19 40,062,206 (GRCm39) missense probably benign 0.20
R6182:Cyp2c54 UTSW 19 40,036,005 (GRCm39) missense probably benign
R6754:Cyp2c54 UTSW 19 40,060,004 (GRCm39) missense probably damaging 1.00
R6901:Cyp2c54 UTSW 19 40,058,703 (GRCm39) missense probably damaging 1.00
R6948:Cyp2c54 UTSW 19 40,034,636 (GRCm39) missense possibly damaging 0.73
R7215:Cyp2c54 UTSW 19 40,034,626 (GRCm39) missense probably damaging 1.00
R7244:Cyp2c54 UTSW 19 40,035,953 (GRCm39) missense probably damaging 1.00
R7278:Cyp2c54 UTSW 19 40,058,697 (GRCm39) nonsense probably null
R7535:Cyp2c54 UTSW 19 40,058,716 (GRCm39) missense probably benign
R7838:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R8039:Cyp2c54 UTSW 19 40,062,176 (GRCm39) frame shift probably null
R8275:Cyp2c54 UTSW 19 40,026,749 (GRCm39) missense probably benign 0.00
R8340:Cyp2c54 UTSW 19 40,060,831 (GRCm39) missense possibly damaging 0.94
R8367:Cyp2c54 UTSW 19 40,062,125 (GRCm39) missense probably damaging 0.99
R8477:Cyp2c54 UTSW 19 40,058,708 (GRCm39) missense probably benign 0.43
R8487:Cyp2c54 UTSW 19 40,059,990 (GRCm39) missense probably damaging 1.00
R8519:Cyp2c54 UTSW 19 40,026,857 (GRCm39) missense probably damaging 0.99
R8534:Cyp2c54 UTSW 19 40,036,030 (GRCm39) missense probably damaging 0.99
R8858:Cyp2c54 UTSW 19 40,062,227 (GRCm39) missense probably benign 0.00
R9215:Cyp2c54 UTSW 19 40,035,950 (GRCm39) missense possibly damaging 0.52
R9236:Cyp2c54 UTSW 19 40,060,938 (GRCm39) nonsense probably null
R9470:Cyp2c54 UTSW 19 40,060,888 (GRCm39) missense probably damaging 1.00
R9792:Cyp2c54 UTSW 19 40,034,525 (GRCm39) missense probably damaging 1.00
Z1176:Cyp2c54 UTSW 19 40,034,659 (GRCm39) missense probably damaging 1.00
Z1177:Cyp2c54 UTSW 19 40,062,201 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTGTGGCGTTTCTACTCACAAGATGAT -3'
(R):5'- GGTAAACTCCACACGGGTTTTGGTAT -3'

Sequencing Primer
(F):5'- GTATATAAACTCTTTACCTGGGCTCC -3'
(R):5'- CTCACGCAGACATCTTAAGTTC -3'
Posted On 2014-04-24